Clec12A Antibody Recognizing Monkey Homolog

Lab Reagents

Human IgG antibody Laboratories manufactures the clec12a antibody recognizing monkey homolog reagents distributed by Genprice. The Clec12A Antibody Recognizing Monkey Homolog reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact monkey Antibody. Other Clec12A products are available in stock. Specificity: Clec12A Category: Antibody Group: Recognizing Monkey

Recognizing Monkey information

CLEC12A Rabbit pAb

A6250-20ul 20 ul
EUR 183

CLEC12A Rabbit pAb

A6250-50ul 50 ul
EUR 223

CLEC12A cloning plasmid

CSB-CL725176HU1-10ug 10ug
EUR 289
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 642
  • Sequence: atgtctgaagaagttacttatgcagatcttcaattccagaactccagtgagatggaaaaaatcccagaaattggcaaatttggggaaaaagcacctccagctccctctcatgtatggcgtccagcagccttgtttctgactcttctgtgccttctgttgctcattggattgggagt
  • Show more
Description: A cloning plasmid for the CLEC12A gene.

CLEC12A cloning plasmid

CSB-CL725176HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 798
  • Sequence: atgtctgaagaagttacttatgcagatcttcaattccagaactccagtgagatggaaaaaatcccagaaattggcaaatttggggaaaaagcacctccagctccctctcatgtatggcgtccagcagccttgtttctgactcttctgtgccttctgttgctcattggattgggagt
  • Show more
Description: A cloning plasmid for the CLEC12A gene.

Human CLEC12A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Clec12a ELISA KIT

ELI-25306m 96 Tests
EUR 865


ELI-25976h 96 Tests
EUR 824


EF004798 96 Tests
EUR 689

Mouse CLEC12A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Human CLEC12A Protein

RP01018 5 μg
EUR 193

CLEC12A Recombinant Protein (Human)

RP038104 100 ug Ask for price

CLEC12A Recombinant Protein (Human)

RP007282 100 ug Ask for price

CLEC12A Recombinant Protein (Rat)

RP195278 100 ug Ask for price

CLEC12A Recombinant Protein (Mouse)

RP124550 100 ug Ask for price

CLEC12A ORF Vector (Human) (pORF)

ORF002428 1.0 ug DNA
EUR 95

Clec12a ORF Vector (Rat) (pORF)

ORF065094 1.0 ug DNA
EUR 506

Clec12a ORF Vector (Mouse) (pORF)

ORF041518 1.0 ug DNA
EUR 506