ERK and Akt exhibit distinct signaling responses following stimulation by pro-angiogenic factors

ERK and Akt exhibit distinct signaling responses following stimulation by pro-angiogenic factors

Background: Angiogenesis plays an important role in the survival of tissue, such as blood vessels deliver oxygen and nutrients needed by the cells of the population. Thus, targeting angiogenesis is a prominent strategy in a variety of settings, including both tissue engineering and cancer treatment. However, not all approaches that modulate angiogenesis lead to a successful outcome. angiogenesis based therapies primarily targeting pro-angiogenic factors such as vascular endothelial growth factor-A (VEGF) or fibroblast growth factor (FGF) in isolation, and there is a limited understanding of how these promoters combine together to stimulate angiogenesis. Target one pathway could be enough, because the alternative pathways can compensate, reducing the overall effect of a treatment strategy.

Methods: To gain insight into the mechanistic and identify new therapeutic strategy, we have developed a detailed mathematical models to quantitatively characterize crosstalk of FGF and VEGF intracellular signaling. The model focuses on FGF- and VEGF-induced MAPK (MAPK) signaling to promote cell proliferation and phosphatidylinositol 3-kinase / protein kinase B (PI3K / Akt) pathway, which promotes cell survival and migration. We fit the model for experimental datasets published the size of phosphorylated extracellular regulated kinase (perk) and Akt (pAkt) on FGF or VEGF stimulation. We validate the model with a separate set of data.

Results: We apply mathematical models are trained and validated to characterize the dynamics of Perk and pAkt in response to mono and co-stimulation by FGF and VEGF. The model predicts that for a certain range of ligand concentration, maximum Perk level is more responsive to changes in ligand concentration compared with the maximum level of pAkt. Also, the combination of FGF and VEGF showed a greater effect in increasing the maximum perk than the sum of the individual effects, which are not visible to the maximum pAkt levels. In addition, we identify the model and kinetic parameters affect the species that specifically modulate Perk and pAkt response, which is a potential target for the treatment of angiogenesis-based.

Conclusion: Overall, the model predicts the effect of a combination of FGF and VEGF stimulation on ERK and Akt quantitative and provides a framework for the mechanic to explain experimental results and guide experimental design. Thus, this model can be used to study the effects of the therapy pro- and anti-angiogenic primarily targeting ERK and / or activation of Akt on stimulation with FGF and VEGF. Video Abstract.

 ERK and Akt exhibit distinct signaling responses following stimulation by pro-angiogenic factors
ERK and Akt exhibit distinct signaling responses following stimulation by pro-angiogenic factors

TGF-β3 Pressing melanogenesis in cultured human melanocytes with neighboring cells and UV-irradiated human skin

Background: Ultraviolet radiation (UVR) is the most well-known causes of skin pigmentation is accompanied with photoaging. Transforming growth factor (TGF) -β1 shown previously have anti-melanogenic property; However, it can cause scarring in the skin.
Objective: We investigated the effect of TGF-β3 on melanogenesis in cultured human melanocytes in the skin constituent cells UV-irradiated and UV-irradiated human skin.

Methods: UVB radiation or treatment with stem cell factor (SCF) and endothelin-1 (ET-1) was applied to human melanocytes cocultured with keratinocytes and / or fibroblasts and ex vivo human skin. mechanistic pathways are further explored after treatment with TGF-β3.

Results: While UVB radiation or SCF / ET-1 enhanced melanogenesis, TGF-β3 accumulation effectively inhibits melanin and tyrosinase activity through downregulation of extracellular signal-regulated kinase (ERK) / microphthalmia associated transcription factor (MITF) pathway. TGF-β3 increased expression of keratinocyte differentiation markers.

Mouse Fibroblast Growth Factor 13 (FGF13) ELISA Kit

DLR-FGF13-Mu-48T 48T
EUR 474
  • Should the Mouse Fibroblast Growth Factor 13 (FGF13) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Fibroblast Growth Factor 13 (FGF13) in samples from serum, plasma or other biological fluids.

Mouse Fibroblast Growth Factor 13 (FGF13) ELISA Kit

DLR-FGF13-Mu-96T 96T
EUR 614
  • Should the Mouse Fibroblast Growth Factor 13 (FGF13) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Fibroblast Growth Factor 13 (FGF13) in samples from serum, plasma or other biological fluids.

Rat Fibroblast Growth Factor 13 (FGF13) ELISA Kit

DLR-FGF13-Ra-48T 48T
EUR 495
  • Should the Rat Fibroblast Growth Factor 13 (FGF13) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Fibroblast Growth Factor 13 (FGF13) in samples from serum, plasma or other biological fluids.

Rat Fibroblast Growth Factor 13 (FGF13) ELISA Kit

DLR-FGF13-Ra-96T 96T
EUR 644
  • Should the Rat Fibroblast Growth Factor 13 (FGF13) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Fibroblast Growth Factor 13 (FGF13) in samples from serum, plasma or other biological fluids.

Human Fibroblast Growth Factor 13 (FGF13) ELISA Kit

RDR-FGF13-Hu-48Tests 48 Tests
EUR 481

Human Fibroblast Growth Factor 13 (FGF13) ELISA Kit

RDR-FGF13-Hu-96Tests 96 Tests
EUR 665

Mouse Fibroblast Growth Factor 13 (FGF13) ELISA Kit

RDR-FGF13-Mu-48Tests 48 Tests
EUR 493

Mouse Fibroblast Growth Factor 13 (FGF13) ELISA Kit

RDR-FGF13-Mu-96Tests 96 Tests
EUR 683

Rat Fibroblast Growth Factor 13 (FGF13) ELISA Kit

RDR-FGF13-Ra-48Tests 48 Tests
EUR 519

Rat Fibroblast Growth Factor 13 (FGF13) ELISA Kit

RDR-FGF13-Ra-96Tests 96 Tests
EUR 720

Human Fibroblast Growth Factor 13 (FGF13) ELISA Kit

RD-FGF13-Hu-48Tests 48 Tests
EUR 460

Human Fibroblast Growth Factor 13 (FGF13) ELISA Kit

RD-FGF13-Hu-96Tests 96 Tests
EUR 636

Mouse Fibroblast Growth Factor 13 (FGF13) ELISA Kit

RD-FGF13-Mu-48Tests 48 Tests
EUR 472

Mouse Fibroblast Growth Factor 13 (FGF13) ELISA Kit

RD-FGF13-Mu-96Tests 96 Tests
EUR 653

Rat Fibroblast Growth Factor 13 (FGF13) ELISA Kit

RD-FGF13-Ra-48Tests 48 Tests
EUR 496

Rat Fibroblast Growth Factor 13 (FGF13) ELISA Kit

RD-FGF13-Ra-96Tests 96 Tests
EUR 688

FGF13 antibody

70R-17291 50 ul
EUR 435
Description: Rabbit polyclonal FGF13 antibody

FGF13 Antibody

35216-100ul 100ul
EUR 252

FGF13 Antibody

35216-50ul 50ul
EUR 187

FGF13 Antibody

DF4699 200ul
EUR 304
Description: FGF13 Antibody detects endogenous levels of total FGF13.

FGF13 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against FGF13. Recognizes FGF13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

FGF13 Antibody

CSB-PA151977-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against FGF13. Recognizes FGF13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

FGF13 antibody

70R-9323 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal FGF13 antibody

FGF13 antibody

70R-6208 50 ug
EUR 467
Description: Rabbit polyclonal FGF13 antibody raised against the middle region of FGF13

FGF13 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FGF13. Recognizes FGF13 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

FGF13 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FGF13. Recognizes FGF13 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200

FGF13 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FGF13. Recognizes FGF13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

FGF13 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FGF13. Recognizes FGF13 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

FGF13 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FGF13. Recognizes FGF13 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FGF13 Antibody

ABD13096 100 ug
EUR 438

FGF13 Antibody

ABD4699 100 ug
EUR 438


YF-PA11772 50 ug
EUR 363
Description: Mouse polyclonal to FGF13


YF-PA11773 100 ug
EUR 403
Description: Rabbit polyclonal to FGF13


YF-PA23708 50 ul
EUR 334
Description: Mouse polyclonal to FGF13

FGF13 Blocking Peptide

33R-9144 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FGF13 antibody, catalog no. 70R-6208

FGF13 Blocking Peptide

33R-7175 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FGF13 antibody, catalog no. 70R-9323

Polyclonal FGF13 Antibody

APR05426G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FGF13 . This antibody is tested and proven to work in the following applications:

FGF13 Blocking Peptide

DF4699-BP 1mg
EUR 195

FGF13 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

FGF13 Conjugated Antibody

C35216 100ul
EUR 397

FGF13 cloning plasmid

CSB-CL008619HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 738
  • Sequence: atggcggcggctatcgccagctcgctcatccgtcagaagaggcaagcccgcgagcgcgagaaatccaacgcctgcaagtgtgtcagcagccccagcaaaggcaagaccagctgcgacaaaaacaagttaaatgtcttttcccgggtcaaactcttcggctccaagaagaggcgcag
  • Show more
Description: A cloning plasmid for the FGF13 gene.

FGF13 Polyclonal Antibody

A59126 100 µg
EUR 570.55
Description: Ask the seller for details

FGF13 Rabbit pAb

A7895-100ul 100 ul
EUR 308

FGF13 Rabbit pAb

A7895-200ul 200 ul
EUR 459

FGF13 Rabbit pAb

A7895-20ul 20 ul
EUR 183

FGF13 Rabbit pAb

A7895-50ul 50 ul
EUR 223

anti- FGF13 antibody

FNab03090 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: fibroblast growth factor 13
  • Uniprot ID: Q92913
  • Gene ID: 2258
  • Research Area: Signal Transduction, Cardiovascular, Immunology, Developmental biology, Neuroscience
Description: Antibody raised against FGF13

Anti-FGF13 Antibody

PA1672 100ug/vial
EUR 294

Anti-FGF13 antibody

PAab03090 100 ug
EUR 355

Anti-FGF13 antibody

STJ110204 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. This gene is located in a region on chromosome X, which is associated with Borjeson-Forssman-Lehmann syndrome (BFLS), making it a possible candidate gene for familial cases of the BFLS, and for other syndromal and nonspecific forms of X-linked mental retardation mapping to this region. Alternative splicing of this gene at the 5' end results in several transcript variants encoding different isoforms with different N-termini.


EF009617 96 Tests
EUR 689

Rat FGF13 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FGF13 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FGF13. Recognizes FGF13 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FGF13 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FGF13. Recognizes FGF13 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FGF13 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FGF13. Recognizes FGF13 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

FGF13 (Isoform 1) Antibody

abx431249-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Mouse FGF13 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FGF13 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FGF13 Polyclonal Antibody, Biotin Conjugated

A59127 100 µg
EUR 570.55
Description: The best epigenetics products

FGF13 Polyclonal Antibody, FITC Conjugated

A59128 100 µg
EUR 570.55
Description: kits suitable for this type of research

FGF13 Polyclonal Antibody, HRP Conjugated

A59129 100 µg
EUR 570.55
Description: fast delivery possible

Fgf13 ORF Vector (Rat) (pORF)

ORF067093 1.0 ug DNA
EUR 506

FGF13 ORF Vector (Human) (pORF)

ORF004034 1.0 ug DNA
EUR 95

Fgf13 ORF Vector (Mouse) (pORF)

ORF044814 1.0 ug DNA
EUR 506

Anti-FGF13 (isoform 1) antibody

STJ72910 100 µg
EUR 359

Fgf13 ELISA Kit (Mouse) (OKCD01720)

OKCD01720 96 Wells
EUR 857
Description: Description of target: Microtubule-binding protein which directly binds tubulin and is involved in both polymerization and stabilization of microtubules. Through its action on microtubules, may participate to the refinement of axons by negatively regulating axonal and leading processes branching. Plays a crucial role in neuron polarization and migration in the cerebral cortex and the hippocampus. Isoform 1 seems not to be involved in neuroblast polarization and migration but regulates axon branching. May regulate voltage-gated sodium channels transport and function. May also play a role in MAPK signaling. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 13.6 pg/mL

FGF13 ELISA Kit (Rat) (OKCD00187)

OKCD00187 96 Wells
EUR 896
Description: Description of target: Microtubule-binding protein which directly binds tubulin and is involved in both polymerization and stabilization of microtubules. Through its action on microtubules, may participate to the refinement of axons by negatively regulating axonal and leading processes branching. Plays a crucial role in neuron polarization and migration in the cerebral cortex and the hippocampus (By similarity).By similarity May regulate voltage-gated sodium channels transport and function.By similarity May also play a role in MAPK signaling.By similarity ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 5.4 pg/mL

FGF13 ELISA Kit (Human) (OKCD05284)

OKCD05284 96 Wells
EUR 909
Description: Description of target: FGF13 is probably involved in nervous system development and function.The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. This gene is located to a region associated with Borjeson-Forssman-Lehmann syndrome (BFLS), a syndromal X-linked mental retardation, which suggests it may be a candidate gene for familial cases of the BFL syndrome. The function of this gene has not yet been determined. Two alternatively spliced transcripts encoding different isoforms have been described for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.53pg/mL

Human Fibroblast growth factor 13 (FGF13)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 31.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Fibroblast growth factor 13(FGF13) expressed in E.coli

Active Fibroblast Growth Factor 13 (FGF13)

  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • EUR 1164.00
  • EUR 2228.00
  • EUR 700.00
  • EUR 8080.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9ERW3
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.9kDa
  • Isoelectric Point: 9.2
Description: Recombinant Rat Fibroblast Growth Factor 13 expressed in: E.coli

Fibroblast Growth Factor 13 (FGF13) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 13 (FGF13) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 13 (FGF13) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fibroblast Growth Factor 13 (FGF13) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Fibroblast Growth Factor 13 (FGF13) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Fibroblast Growth Factor 13 (FGF13) Antibody

  • EUR 467.00
  • EUR 133.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fibroblast Growth Factor 13 (FGF13) Antibody

  • EUR 481.00
  • EUR 133.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fibroblast Growth Factor 13 (FGF13) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fibroblast Growth Factor 13 (FGF13) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fibroblast Growth Factor 13 (FGF13) Antibody

  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

Fibroblast Growth Factor 13 (FGF13) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Fibroblast Growth Factor 13 (FGF13) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 13 (FGF13) Antibody

abx122880-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 13 (FGF13) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 13 (FGF13) Antibody

  • EUR 342.00
  • EUR 857.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fibroblast Growth Factor 13 (FGF13) Antibody

  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Fibroblast Growth Factor 13 (FGF13) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 13 (FGF13) Antibody

abx233090-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Fibroblast Growth Factor 13 (FGF13) Antibody

abx330957-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 13 (FGF13) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 13 (FGF13) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 13 (FGF13) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fgf13 sgRNA CRISPR Lentivector set (Rat)

K7114401 3 x 1.0 ug
EUR 339

FGF13 sgRNA CRISPR Lentivector set (Human)

K0778401 3 x 1.0 ug
EUR 339

Fgf13 sgRNA CRISPR Lentivector set (Mouse)

K4392401 3 x 1.0 ug
EUR 339

Recombinant Fibroblast Growth Factor 13 (FGF13)

  • EUR 592.80
  • EUR 262.00
  • EUR 1948.00
  • EUR 716.00
  • EUR 1332.00
  • EUR 460.00
  • EUR 4720.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q92913
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Fibroblast Growth Factor 13 expressed in: E.coli

Recombinant Fibroblast Growth Factor 13 (FGF13)

  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • EUR 660.00
  • EUR 1220.00
  • EUR 430.00
  • EUR 4300.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q92913
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Fibroblast Growth Factor 13 expressed in: E.coli

Recombinant Fibroblast Growth Factor 13 (FGF13)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9ERW3
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 23.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Fibroblast Growth Factor 13 expressed in: E.coli

Human Fibroblast Growth Factor 13 (FGF13) Protein

  • EUR 815.00
  • EUR 314.00
  • EUR 2611.00
  • EUR 982.00
  • EUR 578.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Fibroblast Growth Factor 13 (FGF13) Protein

  • EUR 759.00
  • EUR 300.00
  • EUR 2388.00
  • EUR 913.00
  • EUR 537.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Rat Fibroblast Growth Factor 13 (FGF13) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

OVA Conjugated Fibroblast Growth Factor 13 (FGF13)

  • EUR 187.81
  • EUR 153.00
  • EUR 429.28
  • EUR 209.76
  • EUR 319.52
  • EUR 188.00
  • EUR 923.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q92913
  • Buffer composition: PBS, pH 7.4.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Human Fibroblast Growth Factor 13 expressed in: chemical synthesis

OVA Conjugated Fibroblast Growth Factor 13 (FGF13)

  • EUR 187.81
  • EUR 153.00
  • EUR 429.28
  • EUR 209.76
  • EUR 319.52
  • EUR 188.00
  • EUR 923.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P70377
  • Buffer composition: PBS, pH 7.4.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Fibroblast Growth Factor 13 expressed in: chemical synthesis

OVA Conjugated Fibroblast Growth Factor 13 (FGF13)

  • EUR 187.81
  • EUR 153.00
  • EUR 429.28
  • EUR 209.76
  • EUR 319.52
  • EUR 188.00
  • EUR 923.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9ERW3
  • Buffer composition: PBS, pH 7.4.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): Inquire
  • Isoelectric Point: Inquire
Description: Recombinant Rat Fibroblast Growth Factor 13 expressed in: chemical synthesis

Polyclonal FGF13 (isoform 1) Antibody (internal region)

APG00862G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human FGF13 (isoform 1) (internal region). This antibody is tested and proven to work in the following applications:

Fibroblast Growth Factor 13 (FGF13) Antibody (Biotin)

  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Fibroblast Growth Factor 13 (FGF13) Antibody Pair

  • EUR 1790.00
  • EUR 1135.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Fibroblast Growth Factor 13 (FGF13) Antibody Pair

  • EUR 1887.00
  • EUR 1191.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Mouse Fibroblast Growth Factor 13 (FGF13) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Fibroblast Growth Factor 13 (FGF13) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Fibroblast Growth Factor 13 (FGF13) Antibody (FITC)

  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Fibroblast Growth Factor 13 (FGF13) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 13 (FGF13) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 13 (FGF13) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fgf13 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7114402 1.0 ug DNA
EUR 154

Fgf13 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7114403 1.0 ug DNA
EUR 154

Fgf13 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7114404 1.0 ug DNA
EUR 154

FGF13 sgRNA CRISPR Lentivector (Human) (Target 1)

K0778402 1.0 ug DNA
EUR 154

FGF13 sgRNA CRISPR Lentivector (Human) (Target 2)

K0778403 1.0 ug DNA
EUR 154

FGF13 sgRNA CRISPR Lentivector (Human) (Target 3)

K0778404 1.0 ug DNA
EUR 154

Fgf13 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4392402 1.0 ug DNA
EUR 154

Fgf13 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4392403 1.0 ug DNA
EUR 154

Fgf13 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4392404 1.0 ug DNA
EUR 154

FGF13 Protein Vector (Mouse) (pPB-C-His)

PV179254 500 ng
EUR 603

FGF13 Protein Vector (Mouse) (pPB-N-His)

PV179255 500 ng
EUR 603

FGF13 Protein Vector (Mouse) (pPM-C-HA)

PV179256 500 ng
EUR 603

FGF13 Protein Vector (Mouse) (pPM-C-His)

PV179257 500 ng
EUR 603

FGF13 Protein Vector (Rat) (pPB-C-His)

PV268370 500 ng
EUR 603

FGF13 Protein Vector (Rat) (pPB-N-His)

PV268371 500 ng
EUR 603

FGF13 Protein Vector (Rat) (pPM-C-HA)

PV268372 500 ng
EUR 603

FGF13 Protein Vector (Rat) (pPM-C-His)

PV268373 500 ng
EUR 603

FGF13 Protein Vector (Human) (pPB-C-His)

PV016133 500 ng
EUR 329

FGF13 Protein Vector (Human) (pPB-N-His)

PV016134 500 ng
EUR 329

FGF13 Protein Vector (Human) (pPM-C-HA)

PV016135 500 ng
EUR 329

FGF13 Protein Vector (Human) (pPM-C-His)

PV016136 500 ng
EUR 329

Fgf13 3'UTR GFP Stable Cell Line

TU156532 1.0 ml Ask for price

Fgf13 3'UTR Luciferase Stable Cell Line

TU106532 1.0 ml Ask for price

Fgf13 3'UTR Luciferase Stable Cell Line

TU204598 1.0 ml Ask for price

Fgf13 3'UTR GFP Stable Cell Line

TU254598 1.0 ml Ask for price

FGF13 3'UTR GFP Stable Cell Line

TU057927 1.0 ml
EUR 1394

FGF13 3'UTR Luciferase Stable Cell Line

TU007927 1.0 ml
EUR 1394

FGF13 Chemi-Luminescent ELISA Kit (Rat) (OKCD03468)

OKCD03468 96 Wells
EUR 1066
Description: Description of target: Microtubule-binding protein which directly binds tubulin and is involved in both polymerization and stabilization of microtubules. Through its action on microtubules, may participate to the refinement of axons by negatively regulating axonal and leading processes branching. Plays a crucial role in neuron polarization and migration in the cerebral cortex and the hippocampus .;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.63 pg/mL

FGF13 Chemi-Luminescent ELISA Kit (Mouse) (OKCD03469)

OKCD03469 96 Wells
EUR 1027
Description: Description of target: Microtubule-binding protein which directly binds tubulin and is involved in both polymerization and stabilization of microtubules. Through its action on microtubules, may participate to the refinement of axons by negatively regulating axonal and leading processes branching. Plays a crucial role in neuron polarization and migration in the cerebral cortex and the hippocampus. Isoform 1 seems not to be involved in neuroblast polarization and migration but regulates axon branching. May regulate voltage-gated sodium channels transport and function. May also play a role in MAPK signaling. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 31.25 pg/mL

FGF13 Chemi-Luminescent ELISA Kit (Human) (OKCD05584)

OKCD05584 96 Wells
EUR 1053
Description: Description of target: FGF13 is probably involved in nervous system development and function.The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. This gene is located to a region associated with Borjeson-Forssman-Lehmann syndrome (BFLS), a syndromal X-linked mental retardation, which suggests it may be a candidate gene for familial cases of the BFL syndrome. The function of this gene has not yet been determined. Two alternatively spliced transcripts encoding different isoforms have been described for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.28pg/mL

Human Fibroblast Growth Factor 13 (FGF13) CLIA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Fibroblast Growth Factor 13 (FGF13) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Fibroblast Growth Factor 13 (FGF13) CLIA Kit

  • EUR 8443.00
  • EUR 4497.00
  • EUR 1036.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Fibroblast Growth Factor 13 (FGF13) CLIA Kit

  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Fibroblast Growth Factor 13 (FGF13) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Fibroblast Growth Factor 13 (FGF13) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Fibroblast Growth Factor 13 (FGF13) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Fibroblast Growth Factor 13 (FGF13) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Fibroblast growth factor 13, FGF13 ELISA KIT

ELI-12896h 96 Tests
EUR 824

Human Fibroblast Growth Factor 13 (FGF13) ELISA Kit

CEC915Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fibroblast Growth Factor 13 (FGF13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Fibroblast Growth Factor 13 (FGF13) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Fibroblast Growth Factor 13 (FGF13) ELISA Kit

CEC915Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fibroblast Growth Factor 13 (FGF13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Fibroblast Growth Factor 13 (FGF13) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Fibroblast Growth Factor 13 (FGF13) ELISA Kit

CEC915Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fibroblast Growth Factor 13 (FGF13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Fibroblast Growth Factor 13 (FGF13) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Fibroblast Growth Factor 13 (FGF13) ELISA Kit

CEC915Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fibroblast Growth Factor 13 (FGF13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Fibroblast Growth Factor 13 (FGF13) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Fibroblast Growth Factor 13 (FGF13) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Fibroblast Growth Factor 13 elisa. Alternative names of the recognized antigen: FHF2
  • Fibroblast Growth Factor Homologous Factor 2
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Fibroblast Growth Factor 13 (FGF13) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Fibroblast Growth Factor 13 (FGF13)CLIA Kit

CCC915Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fibroblast Growth Factor 13 (FGF13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Competitive Chemiluminescent immunoassay for detection of Human Fibroblast Growth Factor 13 (FGF13) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Fibroblast Growth Factor 13 (FGF13)CLIA Kit

CCC915Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fibroblast Growth Factor 13 (FGF13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Competitive Chemiluminescent immunoassay for detection of Human Fibroblast Growth Factor 13 (FGF13) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Fibroblast Growth Factor 13 (FGF13)CLIA Kit

CCC915Hu-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fibroblast Growth Factor 13 (FGF13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Competitive Chemiluminescent immunoassay for detection of Human Fibroblast Growth Factor 13 (FGF13) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Fibroblast Growth Factor 13 (FGF13)CLIA Kit

CCC915Hu-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fibroblast Growth Factor 13 (FGF13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Competitive Chemiluminescent immunoassay for detection of Human Fibroblast Growth Factor 13 (FGF13) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Fibroblast Growth Factor 13 (FGF13) CLIA Kit

  • EUR 5698.00
  • EUR 3061.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Fibroblast Growth Factor 13 Clia kit. Alternative names of the recognized antigen: FHF2
  • Fibroblast Growth Factor Homologous Factor 2
Description: Competitive Inhibition chemiluminescent immunoassay for detection of Human Fibroblast Growth Factor 13 (FGF13)serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids

Human Fibroblast Growth Factor 13 (FGF13) Protein (Active)

  • EUR 1344.00
  • EUR 467.00
  • EUR 4574.00
  • EUR 1636.00
  • EUR 899.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Fibroblast Growth Factor 13 (FGF13) Protein (OVA)

  • EUR 272.00
  • EUR 189.00
  • EUR 606.00
  • EUR 300.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Fibroblast Growth Factor 13 (FGF13) Protein (OVA)

  • EUR 272.00
  • EUR 189.00
  • EUR 606.00
  • EUR 300.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Fibroblast Growth Factor 13 (FGF13) Protein (OVA)

  • EUR 272.00
  • EUR 189.00
  • EUR 606.00
  • EUR 300.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Fibroblast Growth Factor 13 (FGF13) Protein (Active)

  • EUR 1302.00
  • EUR 453.00
  • EUR 4393.00
  • EUR 1581.00
  • EUR 871.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Fibroblast Growth Factor 13 (FGF13) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Fibroblast growth factor 13, Fgf13 ELISA KIT

ELI-32912m 96 Tests
EUR 865

FGF13 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV626707 1.0 ug DNA
EUR 514

FGF13 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV626711 1.0 ug DNA
EUR 514

FGF13 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV626712 1.0 ug DNA
EUR 514

Fibroblast Growth Factor 13 (FGF13) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FGF13 (Gly108~Arg227)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibroblast Growth Factor 13 (FGF13)

Fibroblast Growth Factor 13 (FGF13) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FGF13 (Glu63~Thr245)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Fibroblast Growth Factor 13 (FGF13)

Fibroblast Growth Factor 13 (FGF13) Polyclonal Antibody (Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FGF13 (Met1~Thr192)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fibroblast Growth Factor 13 (FGF13)

Fibroblast Growth Factor 13 (FGF13) Monoclonal Antibody (Human)

  • EUR 255.00
  • EUR 2642.00
  • EUR 655.00
  • EUR 322.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Gly108~Arg227
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Fibroblast Growth Factor 13 (FGF13)

Fibroblast Growth Factor 13 (FGF13) Monoclonal Antibody (Human)

  • EUR 255.00
  • EUR 2642.00
  • EUR 655.00
  • EUR 322.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Glu63~Thr245
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Fibroblast Growth Factor 13 (FGF13)

FGF13 Fibroblast Growth Factor 13 Human Recombinant Protein

PROTQ92913 Regular: 25ug
EUR 317
Description: FGF13 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 245 amino acids and having a molecular mass of 27.6kDa.;The FGF-13 is purified by proprietary chromatographic techniques.

Rat Fibroblast Growth Factor 13(FGF13)ELISA Kit

QY-E10312 96T
EUR 361

Human Fibroblast Growth Factor 13 (FGF13)CLIA Kit

SCC915Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fibroblast Growth Factor 13 (FGF13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Fibroblast Growth Factor 13 (FGF13) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Fibroblast Growth Factor 13 (FGF13)CLIA Kit

SCC915Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fibroblast Growth Factor 13 (FGF13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Fibroblast Growth Factor 13 (FGF13) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Fibroblast Growth Factor 13 (FGF13)CLIA Kit

SCC915Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fibroblast Growth Factor 13 (FGF13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Fibroblast Growth Factor 13 (FGF13) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Fibroblast Growth Factor 13 (FGF13)CLIA Kit

SCC915Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fibroblast Growth Factor 13 (FGF13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Fibroblast Growth Factor 13 (FGF13) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Fibroblast Growth Factor 13 (FGF13) CLIA Kit

  • EUR 5240.00
  • EUR 2819.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Fibroblast Growth Factor 13 Clia kit. Alternative names of the recognized antigen: FHF2
  • Fibroblast Growth Factor Homologous Factor 2
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human Fibroblast Growth Factor 13 (FGF13)serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids

Mouse Fibroblast Growth Factor 13 (FGF13)CLIA Kit

SCC915Mu-10x96wellstestplate 10x96-wells test plate
EUR 5804.88
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Fibroblast Growth Factor 13 (FGF13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Mouse Fibroblast Growth Factor 13 (FGF13) in serum, plasma and other biological fluids.

Mouse Fibroblast Growth Factor 13 (FGF13)CLIA Kit

SCC915Mu-1x48wellstestplate 1x48-wells test plate
EUR 565.7
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Fibroblast Growth Factor 13 (FGF13) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Mouse Fibroblast Growth Factor 13 (FGF13) in serum, plasma and other biological fluids.

TGF-β3 effectively suppressed UVR-induced melanogenesis showed that topical TGF-β3 may be a suitable candidate for the treatment of hyperpigmentation, UV-related disorders.

Leave A Comment