FGFR4 increases EGFR signaling by inducing AREG expression and attenuates response to EGFR inhibitors in colon cancer

FGFR4 increases EGFR signaling by inducing AREG expression and attenuates response to EGFR inhibitors in colon cancer

Fibroblast growth factor receptor 4 (FGFR4) is known to induce cancer cell proliferation, invasion, and anti-apoptosis through activation of the RAS / RAF / ERK and PI3K / pathways AKT, also known as the molecular basis primary carcinogenesis of colon cancer associated with EGFR signaling. However, the interaction of FGFR4 and EGFR signal with respect to the development of colon cancer is not clear.

Here, we investigated the potential crosstalk between FGFR4 and EGFR, and the effect of anti-EGFR therapy in the treatment of colon cancer. To explore the biological role of FGFR4 in cancer development, RNA-seq is done by using a colon cell line transfected FGFR4. Gene ontology data showed upregulation of genes related to EGFR signaling and we identified that the secret of FGFR4 excess EGFR ligands such as AREG with the activation of EGFR and erbB3 result. These results also demonstrated in vivo study and cooperative interaction of EGFR and FGFR4 promoted tumor growth. In addition, reduced excess FGFR4 cetuximab-induced cytotoxicity and FGFR4 inhibitor combinations (BLU9931) and cetuximab showed profound antitumor effect of cetuximab alone.

Clinically, we found a positive correlation between FGFR4 and AREG expression in tumor tissue but not in normal tissue of the colon cancer patients and these expressions were significantly correlated with poor overall survival in patients treated with cetuximab. Therefore, our results provide a novel mechanism of FGFR4 in connection with the activation of EGFR and FGFR4 inhibitors and cetuximab combination may be a promising therapeutic option to achieve an optimal response to anti-EGFR therapies in colon cancer.


fibroblast growth factor receptor (FGFRs) are often altered in a variety of human cancer cells and is expressed in hepatocellular carcinoma (HCC). Some literature has proven that cell lines HepG2 and Hep3B and we used PD173074, FGFR4 inhibitor, to explore the role of FGFR4 and the underlying mechanisms in the cell lines.

The results showed that a significant PD173074 HepG2 and Hep3B cells arrested in the G1 phase and inhibited cell proliferation. Furthermore, Western blot analysis revealed that PD173074 decreased levels of P-FRS2α, P-ERK, Cdk2, cyclin E and NF-kB (p65) in the core while increasing the level of ubiquitin and CUL3, an E3 ubiquitin ligase that involves the degradation of cyclin E.

 FGFR4 increases EGFR signaling by inducing AREG expression and attenuates response to EGFR inhibitors in colon cancer
FGFR4 increases EGFR signaling by inducing AREG expression and attenuates response to EGFR inhibitors in colon cancer

Thermosensitive poloxamer hydrogel heparin-packed bFGF and NGF to treat spinal cord injury

The application of growth factors (GFs) to treat chronic spinal cord injury (SCI) has been shown to promote axonal regeneration and functional recovery. However, the direct administration of the GFS is limited by the rapid degradation and dilution in the injured site. In addition, SCI recovery is a multifactorial process that requires multiple GFS to participate in tissue regeneration.

Based on these facts, controlled delivery of multiple growth factors (GFs) into the lesion area into an attractive strategy to improve SCI. Currently, we develop GFS-based delivery system (called GFS-HP) consisting of basic fibroblast growth factor (bFGF), nerve growth factor (NGF) and heparin-poloxamer (HP) hydrogels through self-assembly mode.

Mouse Fibroblast Growth Factor 23 (FGF23) ELISA Kit

DLR-FGF23-Mu-48T 48T
EUR 435
  • Should the Mouse Fibroblast Growth Factor 23 (FGF23) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Fibroblast Growth Factor 23 (FGF23) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Fibroblast Growth Factor 23 (FGF23) ELISA Kit

DLR-FGF23-Mu-96T 96T
EUR 561
  • Should the Mouse Fibroblast Growth Factor 23 (FGF23) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Fibroblast Growth Factor 23 (FGF23) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Fibroblast Growth Factor 23 (FGF23) ELISA Kit

DLR-FGF23-Ra-48T 48T
EUR 454
  • Should the Rat Fibroblast Growth Factor 23 (FGF23) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Fibroblast Growth Factor 23 (FGF23) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Fibroblast Growth Factor 23 (FGF23) ELISA Kit

DLR-FGF23-Ra-96T 96T
EUR 587
  • Should the Rat Fibroblast Growth Factor 23 (FGF23) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Fibroblast Growth Factor 23 (FGF23) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Fibroblast Growth Factor 23 (FGF23) ELISA Kit

RD-FGF23-Hu-48Tests 48 Tests
EUR 418

Human Fibroblast Growth Factor 23 (FGF23) ELISA Kit

RD-FGF23-Hu-96Tests 96 Tests
EUR 575

Mouse Fibroblast Growth Factor 23 (FGF23) ELISA Kit

RD-FGF23-Mu-48Tests 48 Tests
EUR 429

Mouse Fibroblast Growth Factor 23 (FGF23) ELISA Kit

RD-FGF23-Mu-96Tests 96 Tests
EUR 591

Rat Fibroblast Growth Factor 23 (FGF23) ELISA Kit

RD-FGF23-Ra-48Tests 48 Tests
EUR 450

Rat Fibroblast Growth Factor 23 (FGF23) ELISA Kit

RD-FGF23-Ra-96Tests 96 Tests
EUR 622

Human Fibroblast Growth Factor 23 (FGF23) ELISA Kit

RDR-FGF23-Hu-48Tests 48 Tests
EUR 436

Human Fibroblast Growth Factor 23 (FGF23) ELISA Kit

RDR-FGF23-Hu-96Tests 96 Tests
EUR 601

Mouse Fibroblast Growth Factor 23 (FGF23) ELISA Kit

RDR-FGF23-Mu-48Tests 48 Tests
EUR 447

Mouse Fibroblast Growth Factor 23 (FGF23) ELISA Kit

RDR-FGF23-Mu-96Tests 96 Tests
EUR 618

Rat Fibroblast Growth Factor 23 (FGF23) ELISA Kit

RDR-FGF23-Ra-48Tests 48 Tests
EUR 470

Rat Fibroblast Growth Factor 23 (FGF23) ELISA Kit

RDR-FGF23-Ra-96Tests 96 Tests
EUR 651

FGF23(FGF23/638) Antibody

BNC610638-100 100uL
EUR 199
Description: Primary antibody against FGF23(FGF23/638), CF660R conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNC610638-500 500uL
EUR 544
Description: Primary antibody against FGF23(FGF23/638), CF660R conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNC400638-100 100uL
EUR 199
Description: Primary antibody against FGF23(FGF23/638), CF640R conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNC400638-500 500uL
EUR 544
Description: Primary antibody against FGF23(FGF23/638), CF640R conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNC430638-100 100uL
EUR 199
Description: Primary antibody against FGF23(FGF23/638), CF543 conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNC430638-500 500uL
EUR 544
Description: Primary antibody against FGF23(FGF23/638), CF543 conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNC470638-100 100uL
EUR 199
Description: Primary antibody against FGF23(FGF23/638), CF647 conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNC470638-500 500uL
EUR 544
Description: Primary antibody against FGF23(FGF23/638), CF647 conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNC550638-100 100uL
EUR 199
Description: Primary antibody against FGF23(FGF23/638), CF555 conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNC550638-500 500uL
EUR 544
Description: Primary antibody against FGF23(FGF23/638), CF555 conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNC040638-100 100uL
EUR 199
Description: Primary antibody against FGF23(FGF23/638), CF405S conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNC040638-500 500uL
EUR 544
Description: Primary antibody against FGF23(FGF23/638), CF405S conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNC050638-100 100uL
EUR 199
Description: Primary antibody against FGF23(FGF23/638), CF405M conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNC050638-500 500uL
EUR 544
Description: Primary antibody against FGF23(FGF23/638), CF405M conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNC680638-100 100uL
EUR 199
Description: Primary antibody against FGF23(FGF23/638), CF568 conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNC680638-500 500uL
EUR 544
Description: Primary antibody against FGF23(FGF23/638), CF568 conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNUM0638-50 50uL
EUR 395
Description: Primary antibody against FGF23(FGF23/638), 1mg/mL

FGF23(FGF23/638) Antibody

BNC700638-100 100uL
EUR 199
Description: Primary antibody against FGF23(FGF23/638), CF770 conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNC700638-500 500uL
EUR 544
Description: Primary antibody against FGF23(FGF23/638), CF770 conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNC940638-100 100uL
EUR 199
Description: Primary antibody against FGF23(FGF23/638), CF594 conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNC940638-500 500uL
EUR 544
Description: Primary antibody against FGF23(FGF23/638), CF594 conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNCH0638-100 100uL
EUR 199
Description: Primary antibody against FGF23(FGF23/638), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNCH0638-500 500uL
EUR 544
Description: Primary antibody against FGF23(FGF23/638), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNC800638-100 100uL
EUR 199
Description: Primary antibody against FGF23(FGF23/638), CF680 conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNC800638-500 500uL
EUR 544
Description: Primary antibody against FGF23(FGF23/638), CF680 conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNC810638-100 100uL
EUR 199
Description: Primary antibody against FGF23(FGF23/638), CF680R conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNC810638-500 500uL
EUR 544
Description: Primary antibody against FGF23(FGF23/638), CF680R conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNCP0638-250 250uL
EUR 383
Description: Primary antibody against FGF23(FGF23/638), PerCP conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNCR0638-250 250uL
EUR 383
Description: Primary antibody against FGF23(FGF23/638), RPE conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNCA0638-250 250uL
EUR 383
Description: Primary antibody against FGF23(FGF23/638), APC conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNCAP0638-100 100uL
EUR 199
Description: Primary antibody against FGF23(FGF23/638), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNCAP0638-500 500uL
EUR 544
Description: Primary antibody against FGF23(FGF23/638), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNCB0638-100 100uL
EUR 199
Description: Primary antibody against FGF23(FGF23/638), Biotin conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNCB0638-500 500uL
EUR 544
Description: Primary antibody against FGF23(FGF23/638), Biotin conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNC880638-100 100uL
EUR 199
Description: Primary antibody against FGF23(FGF23/638), CF488A conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNC880638-500 500uL
EUR 544
Description: Primary antibody against FGF23(FGF23/638), CF488A conjugate, Concentration: 0.1mg/mL

FGF23(FGF23/638) Antibody

BNUB0638-100 100uL
EUR 209
Description: Primary antibody against FGF23(FGF23/638), Concentration: 0.2mg/mL

FGF23(FGF23/638) Antibody

BNUB0638-500 500uL
EUR 458
Description: Primary antibody against FGF23(FGF23/638), Concentration: 0.2mg/mL

Fgf23/ Rat Fgf23 ELISA Kit

ELI-02562r 96 Tests
EUR 886

FGF23 siRNA

20-abx901951
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FGF23 siRNA

20-abx916823
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FGF23 siRNA

20-abx916824
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FGF23 antibody

70R-32433 100 ug
EUR 327
Description: Rabbit polyclonal FGF23 antibody

FGF23 Antibody

ABD3596 100 ug
EUR 438

FGF23 Antibody

34248-100ul 100ul
EUR 252

FGF23 Antibody

34248-50ul 50ul
EUR 187

FGF23 protein

30R-AF040 20 ug
EUR 273
Description: Purified recombinant Human FGF23 protein

FGF23 Antibody

DF3596 200ul
EUR 304
Description: FGF23 Antibody detects endogenous levels of total FGF23.

FGF23 Antibody

1-CSB-PA005032
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FGF23. Recognizes FGF23 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

Fgf23 Antibody

1-CSB-PA008629LA01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Fgf23. Recognizes Fgf23 from Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

FGF23 Antibody

1-CSB-PA13919A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FGF23. Recognizes FGF23 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

FGF23 Antibody

CSB-PA163892-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against FGF23. Recognizes FGF23 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

FGF23 Antibody

CSB-PA163892-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against FGF23. Recognizes FGF23 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

FGF23 Antibody

1-CSB-PA060188
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FGF23. Recognizes FGF23 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/20000

anti-FGF23

YF-PA15529 50 ul
EUR 363
Description: Mouse polyclonal to FGF23

anti-FGF23

YF-PA15530 50 ug
EUR 363
Description: Mouse polyclonal to FGF23

FGF23 Conjugated Antibody

C34248 100ul
EUR 397

FGF23 cloning plasmid

CSB-CL008629HU-10ug 10ug
EUR 321
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 756
  • Sequence: atgttgggggcccgcctcaggctctgggtctgtgccttgtgcagcgtctgcagcatgagcgtcctcagagcctatcccaatgcctccccactgctcggctccagctggggtggcctgatccacctgtacacagccacagccaggaacagctaccacctgcagatccacaagaatgg
  • Show more
Description: A cloning plasmid for the FGF23 gene.

FGF23 Blocking Peptide

20-abx162431
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Anti-FGF23 Antibody

A00478-3 100ug/vial
EUR 294

FGF23 Rabbit pAb

A6124-100ul 100 ul
EUR 308

FGF23 Rabbit pAb

A6124-200ul 200 ul
EUR 459

FGF23 Rabbit pAb

A6124-20ul 20 ul
EUR 183

FGF23 Rabbit pAb

A6124-50ul 50 ul
EUR 223

Fgf23 Polyclonal Antibody

A55822 100 µg
EUR 570.55
Description: Ask the seller for details

FGF23 Rabbit pAb

A14073-100ul 100 ul
EUR 308

FGF23 Rabbit pAb

A14073-200ul 200 ul
EUR 459

FGF23 Rabbit pAb

A14073-20ul 20 ul
EUR 183

FGF23 Rabbit pAb

A14073-50ul 50 ul
EUR 223

FGF23 Blocking Peptide

DF3596-BP 1mg
EUR 195

Anti-FGF23 Antibody

PB9868 100ug/vial
EUR 294

Anti-FGF23 antibody

STJ71073 100 µg
EUR 359

Anti-FGF23 antibody

STJ27877 100 µl
EUR 277
Description: This gene encodes a member of the fibroblast growth factor family of proteins, which possess broad mitogenic and cell survival activities and are involved in a variety of biological processes. The product of this gene regulates phosphate homeostasis and transport in the kidney. The full-length, functional protein may be deactivated via cleavage into N-terminal and C-terminal chains. Mutation of this cleavage site causes autosomal dominant hypophosphatemic rickets (ADHR). Mutations in this gene are also associated with hyperphosphatemic familial tumoral calcinosis (HFTC).

Anti-FGF23 antibody

STJ116008 100 µl
EUR 277
Description: This gene encodes a member of the fibroblast growth factor family of proteins, which possess broad mitogenic and cell survival activities and are involved in a variety of biological processes. The product of this gene regulates phosphate homeostasis and transport in the kidney. The full-length, functional protein may be deactivated via cleavage into N-terminal and C-terminal chains. Mutation of this cleavage site causes autosomal dominant hypophosphatemic rickets (ADHR). Mutations in this gene are also associated with hyperphosphatemic familial tumoral calcinosis (HFTC).

Mouse FGF23 shRNA Plasmid

20-abx975295
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat FGF23 shRNA Plasmid

20-abx987589
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FGF23 ELISA Kit

ELA-E0746h 96 Tests
EUR 824

FGF23 ELISA KIT|Human

EF006823 96 Tests
EUR 689

Human FGF23 shRNA Plasmid

20-abx955357
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Fgf23 Antibody, HRP conjugated

1-CSB-PA008629LB01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Fgf23. Recognizes Fgf23 from Rat. This antibody is HRP conjugated. Tested in the following application: ELISA

Fgf23 Antibody, FITC conjugated

1-CSB-PA008629LC01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Fgf23. Recognizes Fgf23 from Rat. This antibody is FITC conjugated. Tested in the following application: ELISA

Fgf23 Antibody, Biotin conjugated

1-CSB-PA008629LD01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Fgf23. Recognizes Fgf23 from Rat. This antibody is Biotin conjugated. Tested in the following application: ELISA

FGF23 Antibody, HRP conjugated

1-CSB-PA13919B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FGF23. Recognizes FGF23 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FGF23 Antibody, FITC conjugated

1-CSB-PA13919C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FGF23. Recognizes FGF23 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FGF23 Antibody, Biotin conjugated

1-CSB-PA13919D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FGF23. Recognizes FGF23 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Recombinant Human FGF23 Protein

RP00366 10 μg
EUR 221

Anti-Fgf23 (mouse) antibody

STJ72630 100 µg
EUR 359

Human FGF23 ELISA Kit

STJ150442 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of FGF23 in human serum, plasma and other biological fluids

Polyclonal Goat Anti-FGF23 Antibody

APG00121G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-FGF23 . This antibody is tested and proven to work in the following applications:

Rat FGF23 PicoKine ELISA Kit

EK1591 96 wells
EUR 425
Description: For quantitative detection of rat FGF23 in cell culture supernates, serum and plasma (heparin, EDTA).

ELISA kit for Mouse FGF23

EK5626 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse FGF23 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human FGF23 PicoKine ELISA Kit

EK0759 96 wells
EUR 425
Description: For Quantitative Detection of human FGF23 in cell culture supernates, serum and plasma (heparin, EDTA).

Mouse FGF23 PicoKine ELISA Kit

EK1362 96 wells
EUR 425
Description: For quantitative detection of mouse FGF23 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Fgf23 Polyclonal Antibody, HRP Conjugated

A55823 100 µg
EUR 570.55
Description: The best epigenetics products

Fgf23 Polyclonal Antibody, FITC Conjugated

A55824 100 µg
EUR 570.55
Description: kits suitable for this type of research

Fgf23 Polyclonal Antibody, Biotin Conjugated

A55825 100 µg
EUR 570.55
Description: fast delivery possible

FGF23 ORF Vector (Human) (pORF)

ORF004038 1.0 ug DNA
EUR 95

Fgf23 ORF Vector (Rat) (pORF)

ORF067103 1.0 ug DNA
EUR 506

Fgf23 ORF Vector (Mouse) (pORF)

ORF044825 1.0 ug DNA
EUR 506

pECMV-Fgf23-m-FLAG Plasmid

PVT14973 2 ug
EUR 325

FGF23 ELISA Kit (Human) (OKAN06265)

OKAN06265 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the fibroblast growth factor family of proteins, which possess broad mitogenic and cell survival activities and are involved in a variety of biological processes. The product of this gene regulates phosphate homeostasis and transport in the kidney. The full-length, functional protein may be deactivated via cleavage into N-terminal and C-terminal chains. Mutation of this cleavage site causes autosomal dominant hypophosphatemic rickets (ADHR). Mutations in this gene are also associated with hyperphosphatemic familial tumoral calcinosis (HFTC).;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.1 pg/mL

FGF23 ELISA Kit (Mouse) (OKAN06421)

OKAN06421 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the fibroblast growth factor family. The encoded protein regulates phosphate homeostasis and vitamin D metabolism. Mutation of the related gene in humans causes autosomal dominant hypophosphatemic rickets (ADHR). The secreted protein is further cleaved into N- and C-terminal chains, which results in loss of function.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.5 pg/mL

FGF23 ELISA Kit (Human) (OKCD06752)

OKCD06752 96 Wells
EUR 753
Description: Description of target: Recombinant Human Fibroblast Growth Factor-23;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 6.5pg/mL

FGF23 ELISA Kit (Mouse) (OKCD06753)

OKCD06753 96 Wells
EUR 779
Description: Description of target: This gene encodes a member of the fibroblast growth factor family. The encoded protein regulates phosphate homeostasis and vitamin D metabolism. Mutation of the related gene in humans causes autosomal dominant hypophosphatemic rickets (ADHR). The secreted protein is further cleaved into N- and C-terminal chains, which results in loss of function.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 6.5pg/mL

FGF23 ELISA Kit (Rat) (OKCD06754)

OKCD06754 96 Wells
EUR 1001
Description: Description of target: This gene encodes a member of the fibroblast growth factor family of proteins, which possess broad mitogenic and cell survival activities and are involved in a variety of biological processes. The product of this gene regulates phosphate homeostasis and transport in the kidney. The full-length, functional protein may be deactivated via cleavage into N-terminal and C-terminal chains. Mutation of this cleavage site causes autosomal dominant hypophosphatemic rickets (ADHR). Mutations in this gene are also associated with hyperphosphatemic familial tumoral calcinosis (HFTC).;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 5.7pg/mL

FGF23 ELISA Kit (Mouse) (OKEH04074)

OKEH04074 96 Wells
EUR 544
Description: Description of target: This gene encodes a member of the fibroblast growth factor family. The encoded protein regulates phosphate homeostasis and vitamin D metabolism. Mutation of the related gene in humans causes autosomal dominant hypophosphatemic rickets (ADHR). The secreted protein is further cleaved into N- and C-terminal chains, which results in loss of function.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.67 pg/mL

FGF23 ELISA Kit (Human) (OKBB00801)

OKBB00801 96 Wells
EUR 505
Description: Description of target: Fibroblast growth factor 23 or FGF23 is a protein that in humans is encoded by the FGF23 gene. It is a member of the fibroblast growth factor (FGF) family which is responsible for phosphate metabolism. The main function of FGF23 seems to be regulation of phosphate concentration in plasma. FGF23 is secreted by Osteocytes in response to elevated Calcitriol. And it acts on the kidneys, where it decreases the expression of NPT2, a sodium-phosphate cotransporter in the proximal tubule. Thus, FGF23 decreases the reabsorption and increases excretion of phosphate. Also, FGF23 may suppress 1-alpha-hydroxylase, reducing its ability to activate vitamin D and subsequently impairing calcium absorption.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

FGF23 ELISA Kit (Mouse) (OKBB00944)

OKBB00944 96 Wells
EUR 505
Description: Description of target: Fibroblast growth factor 23 or FGF23 is a protein that in humans is encoded by the FGF23 gene. It is a member of the fibroblast growth factor (FGF) family which is responsible for phosphate metabolism. The main function of FGF23 seems to be regulation of phosphate concentration in plasma. FGF23 is secreted by Osteocytes in response to elevated Calcitriol. And it acts on the kidneys, where it decreases the expression of NPT2, a sodium-phosphate cotransporter in the proximal tubule. Thus, FGF23 decreases the reabsorption and increases excretion of phosphate. Also, FGF23 may suppress 1-alpha-hydroxylase, reducing its ability to activate vitamin D and subsequently impairing calcium absorption.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

Fgf23 ELISA Kit (Rat) (OKBB01114)

OKBB01114 96 Wells
EUR 505
Description: Description of target: Fibroblast growth factor 23 or FGF23 is a protein that in humans is encoded by the FGF23 gene. It is a member of the fibroblast growth factor (FGF) family which is responsible for phosphate metabolism. The main function of FGF23 seems to be regulation of phosphate concentration in plasma. FGF23 is secreted by Osteocytes in response to elevated Calcitriol. And it acts on the kidneys, where it decreases the expression of NPT2, a sodium-phosphate cotransporter in the proximal tubule. Thus, FGF23 decreases the reabsorption and increases excretion of phosphate. Also, FGF23 may suppress 1-alpha-hydroxylase, reducing its ability to activate vitamin D and subsequently impairing calcium absorption.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

FGF23 ELISA Kit (Human) (OKEH04624)

OKEH04624 96 Wells
EUR 544
Description: Description of target: This gene encodes a member of the fibroblast growth factor family of proteins, which possess broad mitogenic and cell survival activities and are involved in a variety of biological processes. The product of this gene regulates phosphate homeostasis and transport in the kidney. The full-length, functional protein may be deactivated via cleavage into N-terminal and C-terminal chains. Mutation of this cleavage site causes autosomal dominant hypophosphatemic rickets (ADHR). Mutations in this gene are also associated with hyperphosphatemic familial tumoral calcinosis (HFTC).;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 10 pg/mL

Monoclonal FGF23 (Fibroblast Growth Factor 23) Antibody - With BSA and Azide, Clone: FGF23/638

AMM00110G 0.05mg
EUR 396
Description: A Monoclonal antibody against Human FGF23 (Fibroblast Growth Factor 23) - With BSA and Azide. The antibodies are raised in Mouse and are from clone FGF23/638. This antibody is applicable in E

Monoclonal FGF23 (Fibroblast Growth Factor 23) Antibody - Without BSA and Azide, Clone: FGF23/638

AMM00433G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human FGF23 (Fibroblast Growth Factor 23) - Without BSA and Azide. The antibodies are raised in Mouse and are from clone FGF23/638. This antibody is applicable in E

Active Fibroblast Growth Factor 23 (FGF23)

4-APA746Mu01
  • EUR 879.52
  • EUR 338.00
  • EUR 3023.20
  • EUR 1074.40
  • EUR 2048.80
  • EUR 652.00
  • EUR 7408.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9EPC2
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.7kDa
  • Isoelectric Point: 9.8
Description: Recombinant Mouse Fibroblast Growth Factor 23 expressed in: E.coli

FGF23 sgRNA CRISPR Lentivector set (Human)

K0779301 3 x 1.0 ug
EUR 339

Fibroblast Growth Factor 23 (FGF23) Antibody

20-abx131707
  • EUR 314.00
  • EUR 787.00
  • EUR 411.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fibroblast Growth Factor 23 (FGF23) Antibody

20-abx110407
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 23 (FGF23) Antibody

20-abx121603
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 23 (FGF23) Antibody

20-abx102851
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Fibroblast Growth Factor 23 (FGF23) Antibody

20-abx102852
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Fibroblast Growth Factor 23 (FGF23) Antibody

20-abx102853
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fibroblast Growth Factor 23 (FGF23) Antibody

20-abx102854
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fibroblast Growth Factor 23 (FGF23) Antibody

20-abx006316
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 23 (FGF23) Antibody

20-abx014000
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 23 (FGF23) Antibody

20-abx172404
  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Fibroblast Growth Factor 23 (FGF23) Antibody

20-abx176424
  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Fibroblast Growth Factor 23 (FGF23) Antibody

20-abx176425
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fibroblast Growth Factor 23 (FGF23) Antibody

20-abx176426
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Fibroblast Growth Factor 23 (FGF23) Antibody

20-abx323549
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 23 (FGF23) Antibody

20-abx328108
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 23 (FGF23) Antibody

abx215366-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 23 (FGF23) Antibody

abx331469-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 23 (Fgf23) Antibody

abx432059-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Fibroblast Growth Factor 23 (FGF23) Antibody

abx432686-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Fibroblast Growth Factor 23 (FGF23) Antibody

20-abx301065
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fgf23 sgRNA CRISPR Lentivector set (Mouse)

K4372101 3 x 1.0 ug
EUR 339

Rat Fibroblast growth factor 23 (Fgf23)

1-CSB-YP008629RA
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 27.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Fibroblast growth factor 23(Fgf23) expressed in Yeast

Rat Fibroblast growth factor 23 (Fgf23)

1-CSB-EP008629RA
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 29.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Fibroblast growth factor 23(Fgf23) expressed in E.coli

Fgf23 sgRNA CRISPR Lentivector set (Rat)

K6747701 3 x 1.0 ug
EUR 339

Recombinant Fibroblast Growth Factor 23 (FGF23)

4-RPA746Hu01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9GZV9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 13.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Fibroblast Growth Factor 23 expressed in: E.coli

Recombinant Fibroblast Growth Factor 23 (FGF23)

4-RPA746Hu02
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9GZV9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 10.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Fibroblast Growth Factor 23 expressed in: E.coli

Recombinant Fibroblast Growth Factor 23 (FGF23)

4-RPA746Hu03
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9GZV9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 11.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Fibroblast Growth Factor 23 expressed in: E.coli

Recombinant Fibroblast Growth Factor 23 (FGF23)

4-RPA746Mu01
  • EUR 492.45
  • EUR 235.00
  • EUR 1571.68
  • EUR 590.56
  • EUR 1081.12
  • EUR 392.00
  • EUR 3779.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9EPC2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.1kDa
  • Isoelectric Point: 9.8
Description: Recombinant Mouse Fibroblast Growth Factor 23 expressed in: E.coli

Rat Fibroblast Growth Factor 23 (FGF23) Protein

20-abx653390
  • EUR 773.00
  • EUR 300.00
  • EUR 2444.00
  • EUR 926.00
  • EUR 551.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

FGF23 sgRNA CRISPR Lentivector (Human) (Target 1)

K0779302 1.0 ug DNA
EUR 154

FGF23 sgRNA CRISPR Lentivector (Human) (Target 2)

K0779303 1.0 ug DNA
EUR 154

FGF23 sgRNA CRISPR Lentivector (Human) (Target 3)

K0779304 1.0 ug DNA
EUR 154

Human Fibroblast Growth Factor 23 (FGF23) Protein

20-abx066603
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human Fibroblast Growth Factor 23 (FGF23) Protein

20-abx066604
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human Fibroblast Growth Factor 23 (FGF23) Protein

20-abx066605
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Fibroblast Growth Factor 23 (FGF23) Protein

20-abx066606
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fibroblast Growth Factor 23 (FGF23) Antibody (HRP)

20-abx108961
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 23 (FGF23) Antibody (Biotin)

20-abx106128
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 23 (FGF23) Antibody (FITC)

20-abx107542
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 23 (FGF23) Antibody (Biotin)

20-abx274345
  • EUR 342.00
  • EUR 203.00
  • EUR 857.00
  • EUR 439.00
  • EUR 286.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Fibroblast Growth Factor 23 (FGF23) Antibody (HRP)

20-abx316136
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 23 (FGF23) Antibody (FITC)

20-abx316137
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 23 (FGF23) Antibody (Biotin)

20-abx316138
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 23 (FGF23) Antibody (Biotin)

20-abx272036
  • EUR 425.00
  • EUR 230.00
  • EUR 1191.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Fgf23 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4372102 1.0 ug DNA
EUR 154

Fgf23 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4372103 1.0 ug DNA
EUR 154

Fgf23 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4372104 1.0 ug DNA
EUR 154

Fgf23 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6747702 1.0 ug DNA
EUR 154

Fgf23 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6747703 1.0 ug DNA
EUR 154

Fgf23 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6747704 1.0 ug DNA
EUR 154

FGF23 Protein Vector (Mouse) (pPB-C-His)

PV179298 500 ng
EUR 603

FGF23 Protein Vector (Mouse) (pPB-N-His)

PV179299 500 ng
EUR 603

FGF23 Protein Vector (Mouse) (pPM-C-HA)

PV179300 500 ng
EUR 603

FGF23 Protein Vector (Mouse) (pPM-C-His)

PV179301 500 ng
EUR 603

FGF23 Protein Vector (Rat) (pPB-C-His)

PV268410 500 ng
EUR 603

FGF23 Protein Vector (Rat) (pPB-N-His)

PV268411 500 ng
EUR 603

FGF23 Protein Vector (Rat) (pPM-C-HA)

PV268412 500 ng
EUR 603

FGF23 Protein Vector (Rat) (pPM-C-His)

PV268413 500 ng
EUR 603

FGF23 Protein Vector (Human) (pPB-C-His)

PV016149 500 ng
EUR 329

FGF23 Protein Vector (Human) (pPB-N-His)

PV016150 500 ng
EUR 329

It GFS-HP is a kind of thermosensitive hydrogel that is suitable for administration in vivo orthotopic. Meanwhile, the 3D porous structure of the hydrogel is commonly used to load large quantities GFs.After GFS-HP single injection into the spinal cord lesion, sustained release of NGF and bFGF from HP can significantly improve the survival of neurons, axons regenerate, oppression astrogliosis reactive and recovery of locomotor, when compared with GFS treatment free or HP.

Leave A Comment