Gene expression profiling of fibroblasts in a family with LMNA-related cardiomyopathy reveals molecular pathways implicated in disease pathogenesis

Gene expression profiling of fibroblasts in a family with LMNA-related cardiomyopathy reveals molecular pathways implicated in disease pathogenesis

Background: Intermediate filament proteins that construct the nuclear lamina protein lamin cell including A / C is encoded by the gene LMNA, and is involved in fundamental processes such as nuclear structure, gene expression and signal transduction. LMNA mutations predominantly affect the mesoderm-derived cell lineages in diseases collectively referred to as laminopathies which include dilated cardiomyopathy with conduction defects, various forms of muscular dystrophy and premature aging syndromes as Hutchinson-Gilford Progeria Syndrome. At present, our understanding of the molecular mechanisms that regulate tissue-specific manifestations of laminopathies still limited.


Methods: To gain more insight into the molecular mechanisms of a novel splice-site mutations in LMNA (c.357-2A> G) in a family affected by heart disease, we do deep RNA sequencing and analysis for the nine lines derived fibroblast samples three patients with cardiomyopathy, three unaffected family members, and three unrelated individuals not affected. We validated our findings by the study of quantitative PCR and protein.


Results: We identified eight genes were significantly differentially expressed between fibroblasts mutant and non-mutant, which included downregulated factor insulin growth factor binding protein 5 (IGFBP5) in patient samples. ERK pathway analysis indicates involvement / MAPK signaling pathways consistent with previous studies. We found no significant differences in gene expression of lamin A / C and B-type lamins between groups. In the mutant fibroblasts, RNA-seq confirmed that only LMNA predominantly expressed wild-type allele, and Western blot showed normal levels of the protein lamin A / C


Conclusion:
IGFBP5 can contribute in maintaining homeostasis pathway signaling, which may cause the molecular and structural abnormalities is important in the network are not affected as fibroblasts. the mechanism of compensation of other nuclear membrane protein was not found. Our results also showed that only one copy of the wild allele kind enough to normal levels of the protein lamin A / C to maintain physiological functions in the cell type affected. This indicates that the affected cell types such as heart tissue may be more sensitive to haploinsufficiency of lamin A / C. These results provide insight into the molecular mechanisms of diseases with a possible explanation for tissue specificity LMNA related dilated cardiomyopathy.

 Gene expression profiling of fibroblasts in a family with LMNA-related cardiomyopathy reveals molecular pathways implicated in disease pathogenesis
Gene expression profiling of fibroblasts in a family with LMNA-related cardiomyopathy reveals molecular pathways implicated in disease pathogenesis

A novel multi-targeted tyrosine kinase inhibitor in combination with irinotecan anlotinib have in-vitro anti-tumor activity against lung cancer, small cell lung human

Anlotinib is a multi-targeted tyrosine kinase inhibitor developed independently in China. biological effects remain unclear in small cell lung cancer (SCLC). The current study aimed to evaluate the effects of anlotinib in combination with irinotecan in H446 and H2227 SCLC cell lines and provide new treatment strategies for SCLC. the growth of cells of the two cell lines was inhibited by anlotinib, irinotecan and the combination with a dose-dependent manner.

Chicken Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

DLR-FGF1-Ch-48T 48T
EUR 454
  • Should the Chicken Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken Fibroblast Growth Factor 1, Acidic (FGF1) in samples from serum, plasma or other biological fluids.

Chicken Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

DLR-FGF1-Ch-96T 96T
EUR 587
  • Should the Chicken Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken Fibroblast Growth Factor 1, Acidic (FGF1) in samples from serum, plasma or other biological fluids.

Human Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

DLR-FGF1-Hu-48T 48T
EUR 331
  • Should the Human Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fibroblast Growth Factor 1, Acidic (FGF1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

DLR-FGF1-Hu-96T 96T
EUR 418
  • Should the Human Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fibroblast Growth Factor 1, Acidic (FGF1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

DLR-FGF1-Mu-48T 48T
EUR 435
  • Should the Mouse Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Fibroblast Growth Factor 1, Acidic (FGF1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

DLR-FGF1-Mu-96T 96T
EUR 561
  • Should the Mouse Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Fibroblast Growth Factor 1, Acidic (FGF1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

DLR-FGF1-p-48T 48T
EUR 493
  • Should the Porcine Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Fibroblast Growth Factor 1, Acidic (FGF1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

DLR-FGF1-p-96T 96T
EUR 641
  • Should the Porcine Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Fibroblast Growth Factor 1, Acidic (FGF1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

DLR-FGF1-Ra-48T 48T
EUR 454
  • Should the Rat Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Fibroblast Growth Factor 1, Acidic (FGF1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

DLR-FGF1-Ra-96T 96T
EUR 587
  • Should the Rat Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Fibroblast Growth Factor 1, Acidic (FGF1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Bovine Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RD-FGF1-b-48Tests 48 Tests
EUR 494

Bovine Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RD-FGF1-b-96Tests 96 Tests
EUR 684

Chicken Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RD-FGF1-Ch-48Tests 48 Tests
EUR 450

Chicken Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RD-FGF1-Ch-96Tests 96 Tests
EUR 622

Human Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RD-FGF1-Hu-48Tests 48 Tests
EUR 311

Human Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RD-FGF1-Hu-96Tests 96 Tests
EUR 424

Mouse Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RD-FGF1-Mu-48Tests 48 Tests
EUR 429

Mouse Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RD-FGF1-Mu-96Tests 96 Tests
EUR 591

Porcine Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RD-FGF1-p-48Tests 48 Tests
EUR 494

Porcine Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RD-FGF1-p-96Tests 96 Tests
EUR 684

Rat Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RD-FGF1-Ra-48Tests 48 Tests
EUR 450

Rat Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RD-FGF1-Ra-96Tests 96 Tests
EUR 622

Bovine Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RDR-FGF1-b-48Tests 48 Tests
EUR 516

Bovine Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RDR-FGF1-b-96Tests 96 Tests
EUR 716

Chicken Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RDR-FGF1-Ch-48Tests 48 Tests
EUR 470

Chicken Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RDR-FGF1-Ch-96Tests 96 Tests
EUR 651

Human Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RDR-FGF1-Hu-48Tests 48 Tests
EUR 325

Human Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RDR-FGF1-Hu-96Tests 96 Tests
EUR 442

Mouse Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RDR-FGF1-Mu-48Tests 48 Tests
EUR 447

Mouse Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RDR-FGF1-Mu-96Tests 96 Tests
EUR 618

Porcine Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RDR-FGF1-p-48Tests 48 Tests
EUR 516

Porcine Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RDR-FGF1-p-96Tests 96 Tests
EUR 716

Rat Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RDR-FGF1-Ra-48Tests 48 Tests
EUR 470

Rat Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RDR-FGF1-Ra-96Tests 96 Tests
EUR 651

FGF1

LF-PR013 10 ug
EUR 192
Description: FGF1 protein

FGF1 siRNA

20-abx901949
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FGF1 siRNA

20-abx916815
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FGF1 siRNA

20-abx916816
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Fgf1 antibody

70R-8011 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Fgf1 antibody

Fgf1 antibody

70R-8030 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Fgf1 antibody

FGF1 Antibody

ABD6124 100 ug
EUR 438

FGF1 Antibody

36770-100ul 100ul
EUR 252

FGF1 antibody

38145-100ul 100ul
EUR 252

FGF1 protein

30R-2095 10 ug
EUR 272
Description: Purified recombinant Human Acidic Fibroblast Growth Factor

FGF1 protein

30R-2096 25 ug
EUR 470
Description: Purified recombinant Human Acidic Fibroblast Growth Factor

FGF1 protein

30R-2102 1 mg
EUR 6005
Description: Purified recombinant Human Acidic Fibroblast Growth Factor

FGF1 protein

30R-2334 50 ug
EUR 325
Description: Purified recombinant Human FGF1 protein

FGF1 protein

30R-2335 50 ug
EUR 325
Description: Purified recombinant Mouse FGF1 protein

FGF1 antibody

10R-4098 100 ul
EUR 726
Description: Mouse monoclonal FGF1 antibody

FGF1 antibody

70R-17289 50 ul
EUR 435
Description: Rabbit polyclonal FGF1 antibody

FGF1 antibody

70R-12251 100 ug
EUR 403
Description: Rabbit polyclonal FGF 1 antibody

FGF1 antibody

70R-13668 100 ug
EUR 365
Description: Affinity purified Rabbit polyclonal FGF1 antibody

FGF1 antibody

70R-13853 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal FGF1 antibody

FGF1 Antibody

DF6124 200ul
EUR 304
Description: FGF1 Antibody detects endogenous levels of total FGF1.

FGF1 Antibody

1-CSB-PA954065
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FGF1. Recognizes FGF1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200

FGF1 Antibody

1-CSB-PA008237
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FGF1. Recognizes FGF1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

FGF1 Antibody

1-CSB-PA449957
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FGF1. Recognizes FGF1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

FGF1 Antibody

1-CSB-PA008615ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FGF1. Recognizes FGF1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:500, IF:1:50-1:200

FGF1 Antibody

1-CSB-PA008615ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FGF1. Recognizes FGF1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:500, IF:1:50-1:200

FGF1 Antibody

1-CSB-PA008615GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against FGF1. Recognizes FGF1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

Fgf1 Antibody

1-CSB-PA008615HA01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Fgf1. Recognizes Fgf1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

FGF1 Antibody

1-CSB-PA06379A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FGF1. Recognizes FGF1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

pEGFP-FGF1

PVT17864 2 ug
EUR 258

anti-FGF1

YF-PA11765 50 ul
EUR 363
Description: Mouse polyclonal to FGF1

anti-FGF1

YF-PA11766 50 ug
EUR 363
Description: Mouse polyclonal to FGF1

anti-FGF1

YF-PA11767 100 ul
EUR 403
Description: Rabbit polyclonal to FGF1

anti-FGF1

YF-PA11768 100 ug
EUR 403
Description: Rabbit polyclonal to FGF1

anti-FGF1

YF-PA23703 50 ul
EUR 334
Description: Mouse polyclonal to FGF1

FGF1 cloning plasmid

CSB-CL008615HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 468
  • Sequence: atggctgaaggggaaatcaccaccttcacagccctgaccgagaagtttaatctgcctccagggaattacaagaagcccaaactcctctactgtagcaacgggggccacttcctgaggatccttccggatggcacagtggatgggacaagggacaggagcgaccagcacattcagct
  • Show more
Description: A cloning plasmid for the FGF1 gene.

anti- FGF1 antibody

FNab03087 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:100 - 1:200
  • Immunogen: fibroblast growth factor 1 (acidic)
  • Uniprot ID: P05230
  • Gene ID: 2246
  • Research Area: Signal Transduction, Cardiovascular, Immunology, Developmental biology, Neuroscience
Description: Antibody raised against FGF1

Human FGF1 Protein

abx060150-100ug 100 ug
EUR 509
  • Shipped within 5-10 working days.

FGF1 Rabbit pAb

A0079-100ul 100 ul
EUR 308

FGF1 Rabbit pAb

A0079-200ul 200 ul
EUR 459

FGF1 Rabbit pAb

A0079-20ul 20 ul
EUR 183

FGF1 Rabbit pAb

A0079-50ul 50 ul
EUR 223

FGF1 Rabbit pAb

A0685-100ul 100 ul
EUR 308

FGF1 Rabbit pAb

A0685-200ul 200 ul
EUR 459

FGF1 Rabbit pAb

A0685-20ul 20 ul
EUR 183

FGF1 Rabbit pAb

A0685-50ul 50 ul
EUR 223

Fgf1 Polyclonal Antibody

A52780 100 µg
EUR 570.55
Description: reagents widely cited

FGF1 Polyclonal Antibody

A55415 100 µg
EUR 570.55
Description: Ask the seller for details

Fgf1 Blocking Peptide

33R-5638 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Fgf1 antibody, catalog no. 70R-8011

Fgf1 Blocking Peptide

33R-1373 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Irf2bp1 antibody, catalog no. 70R-9319

Human FGF1 Antibody

32912-05111 150 ug
EUR 261

FGF1 Blocking Peptide

DF6124-BP 1mg
EUR 195

Anti-FGF1 Antibody

PB9241 100ug/vial
EUR 294

Anti-FGF1 Antibody

PB9944 100ug/vial
EUR 334

Anti-FGF1 antibody

PAab03087 100 ug
EUR 386

Anti-FGF1 Antibody

PA1311 100ug/vial
EUR 294

Anti-FGF1 Antibody

RP1005 100ug/vial
EUR 334

Anti-FGF1 antibody

STJ23650 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein functions as a modifier of endothelial cell migration and proliferation, as well as an angiogenic factor. It acts as a mitogen for a variety of mesoderm- and neuroectoderm-derived cells in vitro, thus is thought to be involved in organogenesis. Multiple alternatively spliced variants encoding different isoforms have been described.

Anti-FGF1 antibody

STJ23651 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein functions as a modifier of endothelial cell migration and proliferation, as well as an angiogenic factor. It acts as a mitogen for a variety of mesoderm- and neuroectoderm-derived cells in vitro, thus is thought to be involved in organogenesis. Multiple alternatively spliced variants encoding different isoforms have been described.

Anti-FGF1 (3F5)

YF-MA12986 100 ug
EUR 363
Description: Mouse monoclonal to FGF1

Anti-FGF1 (2E12)

YF-MA10321 100 ug
EUR 363
Description: Mouse monoclonal to FGF1

Anti-FGF1 (1F9)

YF-MA10322 100 ug
EUR 363
Description: Mouse monoclonal to FGF1

Rat FGF1 shRNA Plasmid

20-abx984920
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FGF1 ELISA Kit

ELA-E0032h 96 Tests
EUR 824

FGF1 (Human) ELISA Kit

E4281-100
EUR 729

FGF1 ELISA KIT|Human

EF000328 96 Tests
EUR 689

FGF1 protein (His tag)

80R-1948 100 ug
EUR 349
Description: Recombinant mouse FGF1 protein

Mouse FGF1 shRNA Plasmid

20-abx970313
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FGF1 shRNA Plasmid

20-abx951566
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Fgf1 Antibody, HRP conjugated

1-CSB-PA008615HB01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Fgf1. Recognizes Fgf1 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Fgf1 Antibody, FITC conjugated

1-CSB-PA008615HC01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Fgf1. Recognizes Fgf1 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Fgf1 Antibody, Biotin conjugated

1-CSB-PA008615HD01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Fgf1. Recognizes Fgf1 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

FGF1 Antibody, HRP conjugated

1-CSB-PA06379B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FGF1. Recognizes FGF1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FGF1 Antibody, FITC conjugated

1-CSB-PA06379C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FGF1. Recognizes FGF1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FGF1 Antibody, Biotin conjugated

1-CSB-PA06379D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FGF1. Recognizes FGF1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

pCMV-SPORT6-FGF1 Plasmid

PVT16693 2 ug
EUR 325

ELISA kit for Human FGF1

EK5141 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human FGF1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Mouse FGF1

EK5507 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse FGF1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Rat FGF1

EK5508 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat FGF1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human FGF1 PicoKine ELISA Kit

EK0339 96 wells
EUR 425
Description: For quantitative detection of human FGF1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Mouse FGF1 PicoKine ELISA Kit

EK1172 96 wells
EUR 425
Description: For quantitative detection of mouse FGF1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Rat FGF1 PicoKine ELISA Kit

EK1173 96 wells
EUR 425
Description: For quantitative detection of rat FGF1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Fgf1 Polyclonal Antibody, Biotin Conjugated

A52777 100 µg
EUR 570.55
Description: fast delivery possible

Fgf1 Polyclonal Antibody, FITC Conjugated

A52778 100 µg
EUR 570.55
Description: reagents widely cited

Fgf1 Polyclonal Antibody, HRP Conjugated

A52779 100 µg
EUR 570.55
Description: Ask the seller for details

FGF1 Polyclonal Antibody, HRP Conjugated

A55416 100 µg
EUR 570.55
Description: The best epigenetics products

FGF1 Polyclonal Antibody, FITC Conjugated

A55417 100 µg
EUR 570.55
Description: kits suitable for this type of research

FGF1 Polyclonal Antibody, Biotin Conjugated

A55418 100 µg
EUR 570.55
Description: fast delivery possible

Human FGF1 Antibody (Biotin Conjugate)

32912-05121 150 ug
EUR 369

FGF1 ORF Vector (Human) (pORF)

ORF004031 1.0 ug DNA
EUR 95

Fgf1 ORF Vector (Rat) (pORF)

ORF067089 1.0 ug DNA
EUR 506

Fgf1 ORF Vector (Mouse) (pORF)

ORF044809 1.0 ug DNA
EUR 506

FGF1 ELISA Kit (Human) (OKAN04551)

OKAN04551 96 Wells
EUR 792
Description: Description of target: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein functions as a modifier of endothelial cell migration and proliferation, as well as an angiogenic factor. It acts as a mitogen for a variety of mesoderm- and neuroectoderm-derived cells in vitro, thus is thought to be involved in organogenesis. Multiple alternatively spliced variants encoding different isoforms have been described.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.5 pg/mL

FGF1 ELISA Kit (Mouse) (OKAN05038)

OKAN05038 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.7 pg/mL

FGF1 ELISA Kit (Rat) (OKAN05039)

OKAN05039 96 Wells
EUR 792
Description: Description of target: may play a role in neurite outgrowth; may regulate cell differentiation in the nervous system; may act in synergy with fibronectin to enhance neuronal cell adhesion [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.1 pg/mL

FGF1 ELISA Kit (Mouse) (OKBB00520)

OKBB00520 96 Wells
EUR 505
Description: Description of target: Heparin-binding growth factor 1 is a protein that in humans is encoded by the FGF1 gene. The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. This protein functions as a modifier of endothelial cell migration and proliferation, as well as an angiogenic factor. It acts as a mitogen for a variety of mesoderm- and neuroectoderm-derived cells in vitro, thus is thought to be involved in organogenesis. The FGF1 gene was mapped to chromosome 5q31.3-q33.2 by in situ hybridization.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

FGF1 ELISA Kit (Rat) (OKBB00521)

OKBB00521 96 Wells
EUR 505
Description: Description of target: Heparin-binding growth factor 1 is a protein that in humans is encoded by the FGF1 gene. The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. This protein functions as a modifier of endothelial cell migration and proliferation, as well as an angiogenic factor. It acts as a mitogen for a variety of mesoderm- and neuroectoderm-derived cells in vitro, thus is thought to be involved in organogenesis. The FGF1 gene was mapped to chromosome 5q31.3-q33.2 by in situ hybridization.;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

FGF1 ELISA Kit (Bovine) (OKCD05675)

OKCD05675 96 Wells
EUR 1040
Description: Description of target: Bovine Fibroblast Growth Factor-acidic;Species reactivity: Bovine;Application: ELISA;Assay info: ;Sensitivity: < 21.5pg/mL

FGF1 ELISA Kit (Goat) (OKCD05676)

OKCD05676 96 Wells
EUR 909
Description: Description of target: Plays an important role in the regulation of cell survival, cell division, angiogenesis, cell differentiation and cell migration. Functions as potent mitogen in vitro. Acts as a ligand for FGFR1 and integrins. Binds to FGFR1 in the presence of heparin leading to FGFR1 dimerization and activation via sequential autophosphorylation on tyrosine residues which act as docking sites for interacting proteins, leading to the activation of several signaling cascades. Binds to integrin ITGAV:ITGB3. Its binding to integrin, subsequent ternary complex formation with integrin and FGFR1, and the recruitment of PTPN11 to the complex are essential for FGF1 signaling. Induces the phosphorylation and activation of FGFR1, FRS2, MAPK3/ERK1, MAPK1/ERK2 and AKT1. Can induce angiogenesis.;Species reactivity: Goat;Application: ELISA;Assay info: ;Sensitivity: < 31pg/mL

FGF1 ELISA Kit (Chicken) (OKCD05677)

OKCD05677 96 Wells
EUR 818
Description: Description of target: Plays an important role in the regulation of cell survival, cell division, angiogenesis, cell differentiation and cell migration. Functions as potent mitogen in vitro. Acts as a ligand for FGFR1 and integrins. Binds to FGFR1 in the presence of heparin leading to FGFR1 dimerization and activation via sequential autophosphorylation on tyrosine residues which act as docking sites for interacting proteins, leading to the activation of several signaling cascades. Binds to integrins. Its binding to integrins and subsequent ternary complex formation with integrins and FGFR1 are essential for FGF1 signaling.;Species reactivity: Chicken;Application: ELISA;Assay info: ;Sensitivity: < 17.63pg/mL

FGF1 ELISA Kit (Human) (OKCD05678)

OKCD05678 96 Wells
EUR 557
Description: Description of target: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein functions as a modifier of endothelial cell migration and proliferation, as well as an angiogenic factor. It acts as a mitogen for a variety of mesoderm- and neuroectoderm-derived cells in vitro, thus is thought to be involved in organogenesis. Multiple alternatively spliced variants encoding different isoforms have been described.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 6.5pg/mL

FGF1 ELISA Kit (Mouse) (OKCD05679)

OKCD05679 96 Wells
EUR 779
Description: Description of target: The heparin-binding growth factors are angiogenic agents in vivo and are potent mitogens for a variety of cell types in vitro. There are differences in the tissue distribution and concentration of these 2 growth factors.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 5.7pg/mL

FGF1 ELISA Kit (Pig) (OKCD05680)

OKCD05680 96 Wells
EUR 1040
Description: Description of target: Plays an important role in the regulation of cell survival, cell division, angiogenesis, cell differentiation and cell migration. Functions as potent mitogen in vitro. Acts as a ligand for FGFR1 and integrins. Binds to FGFR1 in the presence of heparin leading to FGFR1 dimerization and activation via sequential autophosphorylation on tyrosine residues which act as docking sites for interacting proteins, leading to the activation of several signaling cascades. Binds to integrin ITGAV:ITGB3. Its binding to integrin, subsequent ternary complex formation with integrin and FGFR1, and the recruitment of PTPN11 to the complex are essential for FGF1 signaling. Induces the phosphorylation and activation of FGFR1, FRS2, MAPK3/ERK1, MAPK1/ERK2 and AKT1. Can induce angiogenesis.;Species reactivity: Pig;Application: ELISA;Assay info: ;Sensitivity: < 6.1pg/mL

FGF1 ELISA Kit (Rat) (OKCD05681)

OKCD05681 96 Wells
EUR 818
Description: Description of target: The heparin-binding growth factors are angiogenic agents in vivo and are potent mitogens for a variety of cell types in vitro. There are differences in the tissue distribution and concentration of these 2 growth factors.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 6.1pg/mL

FGF1 ELISA Kit (Mouse) (OKEH04095)

OKEH04095 96 Wells
EUR 596
Description: Description of target: Plays an important role in the regulation of cell survival, cell division, angiogenesis, cell differentiation and cell migration. Functions as potent mitogen in vitro. Acts as a ligand for FGFR1 and integrins. Binds to FGFR1 in the presence of heparin leading to FGFR1 dimerization and activation via sequential autophosphorylation on tyrosine residues which act as docking sites for interacting proteins, leading to the activation of several signaling cascades. Binds to integrin ITGAV:ITGB3. Its binding to integrin, subsequent ternary complex formation with integrin and FGFR1, and the recruitment of PTPN11 to the complex are essential for FGF1 signaling. Induces the phosphorylation and activation of FGFR1, FRS2, MAPK3/ERK1, MAPK1/ERK2 and AKT1. Can induce angiogenesis.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL

Fgf1 ELISA Kit (Rat) (OKEH04535)

OKEH04535 96 Wells
EUR 596
Description: Description of target: May play a role in neurite outgrowth; may regulate cell differentiation in the nervous system; may act in synergy with fibronectin to enhance neuronal cell adhesion.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL

FGF1 ELISA Kit (Human) (OKBB00696)

OKBB00696 96 Wells
EUR 505
Description: Description of target: Heparin-binding growth factor 1 is a protein that in humans is encoded by the FGF1 gene. The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. This protein functions as a modifier of endothelial cell migration and proliferation, as well as an angiogenic factor. It acts as a mitogen for a variety of mesoderm- and neuroectoderm-derived cells in vitro, thus is thought to be involved in organogenesis. The FGF1 gene was mapped to chromosome 5q31.3-q33.2 by in situ hybridization. ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

FGF1 ELISA Kit (Horse) (OKBB00697)

OKBB00697 96 Wells
EUR 505
Description: Description of target: Heparin-binding growth factor 1 is a protein that in humans is encoded by the FGF1 gene. The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. This protein functions as a modifier of endothelial cell migration and proliferation, as well as an angiogenic factor. It acts as a mitogen for a variety of mesoderm- and neuroectoderm-derived cells in vitro, thus is thought to be involved in organogenesis. The FGF1 gene was mapped to chromosome 5q31.3-q33.2 by in situ hybridization. ;Species reactivity: Horse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

FGF1 ELISA Kit (Monkey) (OKBB00698)

OKBB00698 96 Wells
EUR 505
Description: Description of target: Heparin-binding growth factor 1 is a protein that in humans is encoded by the FGF1 gene. The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. This protein functions as a modifier of endothelial cell migration and proliferation, as well as an angiogenic factor. It acts as a mitogen for a variety of mesoderm- and neuroectoderm-derived cells in vitro, thus is thought to be involved in organogenesis. The FGF1 gene was mapped to chromosome 5q31.3-q33.2 by in situ hybridization. ;Species reactivity: Monkey;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

FGF1 ELISA Kit (Dog) (OKEH06345)

OKEH06345 96 Wells
EUR 779
Description: Description of target: Plays an important role in the regulation of cell survival, cell division, angiogenesis, cell differentiation and cell migration. Functions as potent mitogen in vitro. Acts as a ligand for FGFR1 and integrins. Binds to FGFR1 in the presence of heparin leading to FGFR1 dimerization and activation via sequential autophosphorylation on tyrosine residues which act as docking sites for interacting proteins, leading to the activation of several signaling cascades. Binds to integrin ITGAV:ITGB3. Its binding to integrin, subsequent ternary complex formation with integrin and FGFR1, and the recruitment of PTPN11 to the complex are essential for FGF1 signaling. Induces the phosphorylation and activation of FGFR1, FRS2, MAPK3/ERK1, MAPK1/ERK2 and AKT1. Can induce angiogenesis.;Species reactivity: Dog;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 32 pg/mL

FGF1 ELISA Kit (Bovine) (OKEH06352)

OKEH06352 96 Wells
EUR 779
Description: Description of target: Plays an important role in the regulation of cell survival, cell division, angiogenesis, cell differentiation and cell migration. Functions as potent mitogen in vitro. Acts as a ligand for FGFR1 and integrins. Binds to FGFR1 in the presence of heparin leading to FGFR1 dimerization and activation via sequential autophosphorylation on tyrosine residues which act as docking sites for interacting proteins, leading to the activation of several signaling cascades. Binds to integrin ITGAV:ITGB3. Its binding to integrin, subsequent ternary complex formation with integrin and FGFR1, and the recruitment of PTPN11 to the complex are essential for FGF1 signaling. Induces the phosphorylation and activation of FGFR1, FRS2, MAPK3/ERK1, MAPK1/ERK2 and AKT1. Can induce angiogenesis.;Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.053 ng/mL

FGF1 ELISA Kit (Chicken) (OKEH07236)

OKEH07236 96 Wells
EUR 1184
Description: Description of target: ;Species reactivity: Chicken;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39pg/mL

FGF1 ELISA Kit (Pig) (OKEH07237)

OKEH07237 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 19pg/mL

Polyclonal Fgf1 antibody - N-terminal region

APR00647G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Fgf1 - N-terminal region. This antibody is tested and proven to work in the following applications:

Polyclonal Fgf1 antibody - N-terminal region

APR00656G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Fgf1 - N-terminal region. This antibody is tested and proven to work in the following applications:

FGF1 sgRNA CRISPR Lentivector set (Human)

K0777001 3 x 1.0 ug
EUR 339

Fibroblast Growth Factor 1 (FGF1) Antibody

20-abx112524
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 1 (FGF1) Antibody

20-abx109783
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 1 (FGF1) Antibody

20-abx109784
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 1 (FGF1) Antibody

20-abx000547
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 1 (FGF1) Antibody

20-abx000820
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 1 (FGF1) Antibody

20-abx320141
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 1 (FGF1) Antibody

20-abx322141
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 1 (FGF1) Antibody

20-abx326446
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 1 (FGF1) Antibody

20-abx214480
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 1 (FGF1) Antibody

20-abx214934
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 1 (FGF1) Antibody

abx233087-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Human FGF1 AssayLite Antibody (FITC Conjugate)

32912-05141 150 ug
EUR 428

Human FGF1 AssayLite Antibody (RPE Conjugate)

32912-05151 150 ug
EUR 428

Human FGF1 AssayLite Antibody (APC Conjugate)

32912-05161 150 ug
EUR 428

Human FGF1 AssayLite Antibody (PerCP Conjugate)

32912-05171 150 ug
EUR 471

Fgf1 sgRNA CRISPR Lentivector set (Mouse)

K3642701 3 x 1.0 ug
EUR 339

Human Fibroblast growth factor 1 (FGF1)

1-CSB-EP008615HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 31.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Fibroblast growth factor 1(FGF1) expressed in E.coli

Human Fibroblast growth factor 1 (FGF1)

1-CSB-EP008615HUc7
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 17.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Fibroblast growth factor 1(FGF1) expressed in E.coli

Mouse Fibroblast growth factor 1 (Fgf1)

1-CSB-EP008615MO
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 19.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Fibroblast growth factor 1(Fgf1) expressed in E.coli

Fgf1 sgRNA CRISPR Lentivector set (Rat)

K6917901 3 x 1.0 ug
EUR 339

Recombinant human FGF acidic/FGF1 Protein

RP01242 10 μg
EUR 149

Active Fibroblast Growth Factor 1, Acidic (FGF1)

4-APA032Hu01
  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • EUR 660.00
  • EUR 1220.00
  • EUR 430.00
  • EUR 4300.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P05230
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 47.3kDa
  • Isoelectric Point: 6.5
Description: Recombinant Human Fibroblast Growth Factor 1, Acidic expressed in: Available from E.coli, Yeast, Baculovirus and Mammalian cells

Active Fibroblast Growth Factor 1, Acidic (FGF1)

4-APA032Mu01
  • EUR 816.80
  • EUR 322.00
  • EUR 2788.00
  • EUR 996.00
  • EUR 1892.00
  • EUR 610.00
  • EUR 6820.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P61148
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.1kDa
  • Isoelectric Point: 7.2
Description: Recombinant Mouse Fibroblast Growth Factor 1, Acidic expressed in: E.coli

Monoclonal FGF1 Antibody (clone 2E12), Clone: 2E12

AMM01991G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human FGF1 (clone 2E12). The antibodies are raised in Mouse and are from clone 2E12. This antibody is applicable in WB and IHC-P, IF, E, IP

Monoclonal FGF1 Antibody (clone 1F9), Clone: 1F9

AMM01992G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human FGF1 (clone 1F9). The antibodies are raised in Mouse and are from clone 1F9. This antibody is applicable in WB and IHC-P, IF, E

Horse equine FGF1 PicoKine™ ELISA Kit

EK0339-EQ 96 wells
EUR 425
Description: Sandwich High Sensitivity ELISA kit for Quantitative Detection of horse equine FGF1. 96wells/kit, with removable strips.

FGF1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0777002 1.0 ug DNA
EUR 154

FGF1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0777003 1.0 ug DNA
EUR 154

FGF1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0777004 1.0 ug DNA
EUR 154

Fibroblast Growth Factor 1, Acidic (FGF1) Antibody

20-abx130427
  • EUR 467.00
  • EUR 133.00
  • EUR 1372.00
  • EUR 648.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fibroblast Growth Factor 1, Acidic (FGF1) Antibody

20-abx131859
  • EUR 328.00
  • EUR 843.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fibroblast Growth Factor 1 (FGF1) Antibody (HRP)

20-abx108252
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 1 (FGF1) Antibody (HRP)

20-abx108253
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 1, Acidic (FGF1) Antibody

20-abx103579
  • EUR 314.00
  • EUR 133.00
  • EUR 843.00
  • EUR 439.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fibroblast Growth Factor 1, Acidic (FGF1) Antibody

20-abx103580
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fibroblast Growth Factor 1, Acidic (FGF1) Antibody

20-abx103581
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fibroblast Growth Factor 1, Acidic (FGF1) Antibody

20-abx103582
  • EUR 453.00
  • EUR 133.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Fibroblast Growth Factor 1 (FGF1) Antibody (Biotin)

20-abx105414
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 1 (FGF1) Antibody (Biotin)

20-abx105415
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 1 (FGF1) Antibody (FITC)

20-abx106833
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 1 (FGF1) Antibody (FITC)

20-abx106834
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

After 72 hours of incubation, the degree of inhibition was greater in the combination group than all the single drug groups. Similar results were found when apoptosis was assessed after 12 h, but not after 6 hours of treatment. Compared with a single drug, drug combination suppressed the migration and invasion ability in two cell lines; However, there is no difference between anlotinib individual or irinotecan. Colony formation rates clearly lowered in the combination group.

Leave A Comment