Gene expression profiling of fibroblasts in a family with LMNA-related cardiomyopathy reveals molecular pathways implicated in disease pathogenesis

Gene expression profiling of fibroblasts in a family with LMNA-related cardiomyopathy reveals molecular pathways implicated in disease pathogenesis

Background: Intermediate filament proteins that construct the nuclear lamina protein lamin cell including A / C is encoded by the gene LMNA, and is involved in fundamental processes such as nuclear structure, gene expression and signal transduction. LMNA mutations predominantly affect the mesoderm-derived cell lineages in diseases collectively referred to as laminopathies which include dilated cardiomyopathy with conduction defects, various forms of muscular dystrophy and premature aging syndromes as Hutchinson-Gilford Progeria Syndrome. At present, our understanding of the molecular mechanisms that regulate tissue-specific manifestations of laminopathies still limited.


Methods: To gain more insight into the molecular mechanisms of a novel splice-site mutations in LMNA (c.357-2A> G) in a family affected by heart disease, we do deep RNA sequencing and analysis for the nine lines derived fibroblast samples three patients with cardiomyopathy, three unaffected family members, and three unrelated individuals not affected. We validated our findings by the study of quantitative PCR and protein.


Results: We identified eight genes were significantly differentially expressed between fibroblasts mutant and non-mutant, which included downregulated factor insulin growth factor binding protein 5 (IGFBP5) in patient samples. ERK pathway analysis indicates involvement / MAPK signaling pathways consistent with previous studies. We found no significant differences in gene expression of lamin A / C and B-type lamins between groups. In the mutant fibroblasts, RNA-seq confirmed that only LMNA predominantly expressed wild-type allele, and Western blot showed normal levels of the protein lamin A / C


Conclusion:
IGFBP5 can contribute in maintaining homeostasis pathway signaling, which may cause the molecular and structural abnormalities is important in the network are not affected as fibroblasts. the mechanism of compensation of other nuclear membrane protein was not found. Our results also showed that only one copy of the wild allele kind enough to normal levels of the protein lamin A / C to maintain physiological functions in the cell type affected. This indicates that the affected cell types such as heart tissue may be more sensitive to haploinsufficiency of lamin A / C. These results provide insight into the molecular mechanisms of diseases with a possible explanation for tissue specificity LMNA related dilated cardiomyopathy.

 Gene expression profiling of fibroblasts in a family with LMNA-related cardiomyopathy reveals molecular pathways implicated in disease pathogenesis
Gene expression profiling of fibroblasts in a family with LMNA-related cardiomyopathy reveals molecular pathways implicated in disease pathogenesis

A novel multi-targeted tyrosine kinase inhibitor in combination with irinotecan anlotinib have in-vitro anti-tumor activity against lung cancer, small cell lung human

Anlotinib is a multi-targeted tyrosine kinase inhibitor developed independently in China. biological effects remain unclear in small cell lung cancer (SCLC). The current study aimed to evaluate the effects of anlotinib in combination with irinotecan in H446 and H2227 SCLC cell lines and provide new treatment strategies for SCLC. the growth of cells of the two cell lines was inhibited by anlotinib, irinotecan and the combination with a dose-dependent manner.

Chicken Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

DLR-FGF1-Ch-48T 48T
EUR 454
  • Should the Chicken Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken Fibroblast Growth Factor 1, Acidic (FGF1) in samples from serum, plasma or other biological fluids.

Chicken Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

DLR-FGF1-Ch-96T 96T
EUR 587
  • Should the Chicken Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken Fibroblast Growth Factor 1, Acidic (FGF1) in samples from serum, plasma or other biological fluids.

Human Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

DLR-FGF1-Hu-48T 48T
EUR 331
  • Should the Human Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fibroblast Growth Factor 1, Acidic (FGF1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

DLR-FGF1-Hu-96T 96T
EUR 418
  • Should the Human Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fibroblast Growth Factor 1, Acidic (FGF1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

DLR-FGF1-Mu-48T 48T
EUR 435
  • Should the Mouse Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Fibroblast Growth Factor 1, Acidic (FGF1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

DLR-FGF1-Mu-96T 96T
EUR 561
  • Should the Mouse Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Fibroblast Growth Factor 1, Acidic (FGF1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

DLR-FGF1-p-48T 48T
EUR 493
  • Should the Porcine Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Fibroblast Growth Factor 1, Acidic (FGF1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

DLR-FGF1-p-96T 96T
EUR 641
  • Should the Porcine Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine Fibroblast Growth Factor 1, Acidic (FGF1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

DLR-FGF1-Ra-48T 48T
EUR 454
  • Should the Rat Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Fibroblast Growth Factor 1, Acidic (FGF1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

DLR-FGF1-Ra-96T 96T
EUR 587
  • Should the Rat Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Fibroblast Growth Factor 1, Acidic (FGF1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Bovine Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RDR-FGF1-b-48Tests 48 Tests
EUR 516

Bovine Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RDR-FGF1-b-96Tests 96 Tests
EUR 716

Chicken Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RDR-FGF1-Ch-48Tests 48 Tests
EUR 470

Chicken Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RDR-FGF1-Ch-96Tests 96 Tests
EUR 651

Human Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RDR-FGF1-Hu-48Tests 48 Tests
EUR 325

Human Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RDR-FGF1-Hu-96Tests 96 Tests
EUR 442

Mouse Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RDR-FGF1-Mu-48Tests 48 Tests
EUR 447

Mouse Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RDR-FGF1-Mu-96Tests 96 Tests
EUR 618

Porcine Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RDR-FGF1-p-48Tests 48 Tests
EUR 516

Porcine Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RDR-FGF1-p-96Tests 96 Tests
EUR 716

Rat Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RDR-FGF1-Ra-48Tests 48 Tests
EUR 470

Rat Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RDR-FGF1-Ra-96Tests 96 Tests
EUR 651

Bovine Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RD-FGF1-b-48Tests 48 Tests
EUR 494

Bovine Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RD-FGF1-b-96Tests 96 Tests
EUR 684

Chicken Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RD-FGF1-Ch-48Tests 48 Tests
EUR 450

Chicken Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RD-FGF1-Ch-96Tests 96 Tests
EUR 622

Human Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RD-FGF1-Hu-48Tests 48 Tests
EUR 311

Human Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RD-FGF1-Hu-96Tests 96 Tests
EUR 424

Mouse Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RD-FGF1-Mu-48Tests 48 Tests
EUR 429

Mouse Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RD-FGF1-Mu-96Tests 96 Tests
EUR 591

Porcine Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RD-FGF1-p-48Tests 48 Tests
EUR 494

Porcine Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RD-FGF1-p-96Tests 96 Tests
EUR 684

Rat Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RD-FGF1-Ra-48Tests 48 Tests
EUR 450

Rat Fibroblast Growth Factor 1, Acidic (FGF1) ELISA Kit

RD-FGF1-Ra-96Tests 96 Tests
EUR 622

FGF1

LF-PR013 10 ug
EUR 192
Description: FGF1 protein

FGF1 protein

30R-2095 10 ug
EUR 272
Description: Purified recombinant Human Acidic Fibroblast Growth Factor

FGF1 protein

30R-2096 25 ug
EUR 470
Description: Purified recombinant Human Acidic Fibroblast Growth Factor

FGF1 protein

30R-2102 1 mg
EUR 6005
Description: Purified recombinant Human Acidic Fibroblast Growth Factor

FGF1 protein

30R-2334 50 ug
EUR 325
Description: Purified recombinant Human FGF1 protein

FGF1 protein

30R-2335 50 ug
EUR 325
Description: Purified recombinant Mouse FGF1 protein

FGF1 antibody

70R-17289 50 ul
EUR 435
Description: Rabbit polyclonal FGF1 antibody

FGF1 antibody

70R-12251 100 ug
EUR 403
Description: Rabbit polyclonal FGF 1 antibody

FGF1 antibody

70R-13668 100 ug
EUR 365
Description: Affinity purified Rabbit polyclonal FGF1 antibody

FGF1 antibody

70R-13853 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal FGF1 antibody

FGF1 Antibody

36770-100ul 100ul
EUR 252

FGF1 antibody

38145-100ul 100ul
EUR 252

FGF1 antibody

10R-4098 100 ul
EUR 726
Description: Mouse monoclonal FGF1 antibody

FGF1 Antibody

1-CSB-PA06379A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FGF1. Recognizes FGF1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

FGF1 Antibody

1-CSB-PA954065
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FGF1. Recognizes FGF1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200

FGF1 Antibody

DF6124 200ul
EUR 304
Description: FGF1 Antibody detects endogenous levels of total FGF1.

FGF1 Antibody

1-CSB-PA449957
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FGF1. Recognizes FGF1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

Fgf1 antibody

70R-8011 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Fgf1 antibody

Fgf1 antibody

70R-8030 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Fgf1 antibody

FGF1 Antibody

1-CSB-PA008237
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FGF1. Recognizes FGF1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

FGF1 Antibody

1-CSB-PA008615ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FGF1. Recognizes FGF1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:500, IF:1:50-1:200

FGF1 Antibody

1-CSB-PA008615ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FGF1. Recognizes FGF1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:500, IF:1:50-1:200

FGF1 Antibody

1-CSB-PA008615GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against FGF1. Recognizes FGF1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

Fgf1 Antibody

1-CSB-PA008615HA01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Fgf1. Recognizes Fgf1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

FGF1 siRNA

20-abx901949
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FGF1 siRNA

20-abx916815
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FGF1 siRNA

20-abx916816
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FGF1 Antibody

ABD6124 100 ug
EUR 438

pEGFP-FGF1

PVT17864 2 ug
EUR 258

anti-FGF1

YF-PA11765 50 ul
EUR 363
Description: Mouse polyclonal to FGF1

anti-FGF1

YF-PA11766 50 ug
EUR 363
Description: Mouse polyclonal to FGF1

anti-FGF1

YF-PA11767 100 ul
EUR 403
Description: Rabbit polyclonal to FGF1

anti-FGF1

YF-PA11768 100 ug
EUR 403
Description: Rabbit polyclonal to FGF1

anti-FGF1

YF-PA23703 50 ul
EUR 334
Description: Mouse polyclonal to FGF1

FGF1 Rabbit pAb

A0685-100ul 100 ul
EUR 308

FGF1 Rabbit pAb

A0685-200ul 200 ul
EUR 459

FGF1 Rabbit pAb

A0685-20ul 20 ul
EUR 183

FGF1 Rabbit pAb

A0685-50ul 50 ul
EUR 223

Fgf1 Blocking Peptide

33R-5638 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Fgf1 antibody, catalog no. 70R-8011

Fgf1 Blocking Peptide

33R-1373 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Irf2bp1 antibody, catalog no. 70R-9319

Human FGF1 Antibody

32912-05111 150 ug
EUR 261

FGF1 Blocking Peptide

DF6124-BP 1mg
EUR 195

FGF1 Rabbit pAb

A0079-100ul 100 ul
EUR 308

FGF1 Rabbit pAb

A0079-200ul 200 ul
EUR 459

FGF1 Rabbit pAb

A0079-20ul 20 ul
EUR 183

FGF1 Rabbit pAb

A0079-50ul 50 ul
EUR 223

Human FGF1 Protein

abx060150-100ug 100 ug
EUR 509
  • Shipped within 5-10 working days.

FGF1 cloning plasmid

CSB-CL008615HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 468
  • Sequence: atggctgaaggggaaatcaccaccttcacagccctgaccgagaagtttaatctgcctccagggaattacaagaagcccaaactcctctactgtagcaacgggggccacttcctgaggatccttccggatggcacagtggatgggacaagggacaggagcgaccagcacattcagct
  • Show more
Description: A cloning plasmid for the FGF1 gene.

Fgf1 Polyclonal Antibody

A52780 100 µg
EUR 570.55
Description: reagents widely cited

FGF1 Polyclonal Antibody

A55415 100 µg
EUR 570.55
Description: Ask the seller for details

anti- FGF1 antibody

FNab03087 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:100 - 1:200
  • Immunogen: fibroblast growth factor 1 (acidic)
  • Uniprot ID: P05230
  • Gene ID: 2246
  • Research Area: Signal Transduction, Cardiovascular, Immunology, Developmental biology, Neuroscience
Description: Antibody raised against FGF1

Anti-FGF1 Antibody

PA1311 100ug/vial
EUR 294

Anti-FGF1 antibody

PAab03087 100 ug
EUR 386

Anti-FGF1 Antibody

PB9241 100ug/vial
EUR 294

Anti-FGF1 Antibody

PB9944 100ug/vial
EUR 334

Anti-FGF1 Antibody

RP1005 100ug/vial
EUR 334

Anti-FGF1 antibody

STJ23650 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein functions as a modifier of endothelial cell migration and proliferation, as well as an angiogenic factor. It acts as a mitogen for a variety of mesoderm- and neuroectoderm-derived cells in vitro, thus is thought to be involved in organogenesis. Multiple alternatively spliced variants encoding different isoforms have been described.

Anti-FGF1 antibody

STJ23651 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein functions as a modifier of endothelial cell migration and proliferation, as well as an angiogenic factor. It acts as a mitogen for a variety of mesoderm- and neuroectoderm-derived cells in vitro, thus is thought to be involved in organogenesis. Multiple alternatively spliced variants encoding different isoforms have been described.

Anti-FGF1 (2E12)

YF-MA10321 100 ug
EUR 363
Description: Mouse monoclonal to FGF1

Anti-FGF1 (1F9)

YF-MA10322 100 ug
EUR 363
Description: Mouse monoclonal to FGF1

Anti-FGF1 (3F5)

YF-MA12986 100 ug
EUR 363
Description: Mouse monoclonal to FGF1

FGF1 Antibody, HRP conjugated

1-CSB-PA06379B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FGF1. Recognizes FGF1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FGF1 Antibody, FITC conjugated

1-CSB-PA06379C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FGF1. Recognizes FGF1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FGF1 Antibody, Biotin conjugated

1-CSB-PA06379D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FGF1. Recognizes FGF1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

After 72 hours of incubation, the degree of inhibition was greater in the combination group than all the single drug groups. Similar results were found when apoptosis was assessed after 12 h, but not after 6 hours of treatment. Compared with a single drug, drug combination suppressed the migration and invasion ability in two cell lines; However, there is no difference between anlotinib individual or irinotecan. Colony formation rates clearly lowered in the combination group.

Leave A Comment