Human Cytomegalovirus miR-US5-2 Downregulation of GAB1 Regulates Cellular Proliferation and UL138 Expression through Modulation of Epidermal Growth Factor Receptor Signaling Pathways

Regulation of the epidermal growth factor (EGF) receptor (EGFR) signaling is essential for the replication of human cytomegalovirus (HCMV) and the latency and reactivation in CD34 + hematopoietic progenitor cells. HCMV microRNAs (miRNAs) provide a means to modulate the signal is activated by EGF through targeting EGFR signaling pathway components. Here, we show that miR-US5-2 HCMV immediate critical downregulates EGFR GAB1 adapter proteins that mediate sustained activation and signals through phosphatidylinositol 3-kinase (PI3K) and MEK / extracellular signal-regulated kinase (ERK) pathway and cell proliferation in response to EGF.

UL138 HCMV expression is regulated by the transcription factor early growth response gene 1 (EGR1) downstream of EGFR-induced MEK / ERK signaling. We show that by targeting GAB1 and smoothes the MEK / ERK signaling, mir-US5-2 indirectly regulating the expression EGR1 and UL138, which implicates critical miRNA regulation latency.IMPORTANCE HCMV Human cytomegalovirus (HCMV) causes significant illness in immunocompromised individuals, including transplant patients. HCMV establishes latency in the hematopoietic stem cells in the bone marrow.

The mechanisms that regulate the latency and reactivation of viral replication is complex and not fully understood. HCMV-encoded miRNAs are small regulatory RNA that reduces expression of the protein. In this study, we found that HCMV miRNA miR-US5-2 targeting the epidermal growth factor receptor (EGFR) protein GAB1 adapter that directly affect downstream cellular signaling pathways activated by EGF. As a result, mir-US5-2 block EGF-mediated proliferation of human fibroblasts. early growth response gene 1 (EGR1) is a transcription factor activated by EGFR signaling that regulates the expression of HCMV UL138.

We show that miR-UL138 US5-2 regulates expression via downregulation GAB1-mediated signaling pathways that lead to the expression of EGR1. These data demonstrate that miR-US5-2, through downregulation of GAB1, can play an important role during the reactivation from latency by reducing the proliferation and expression of UL138.

 Human Cytomegalovirus miR-US5-2 Downregulation of GAB1 Regulates Cellular Proliferation and UL138 Expression through Modulation of Epidermal Growth Factor Receptor Signaling Pathways
Human Cytomegalovirus miR-US5-2 Downregulation of GAB1 Regulates Cellular Proliferation and UL138 Expression through Modulation of Epidermal Growth Factor Receptor Signaling Pathways

MKP-1 overproduction associated with chemoresistance in bladder cancer through the MAPK pathway

Mitogen-activated protein kinase phosphatase-1 (MKP-1) has been revealed to be expressed in bladder cancer, especially in non-muscle invasive bladder cancer. MKP-1 may also be associated with chemotherapy resistance. However, the underlying mechanism has not been elucidated. The current study examined the expression of MKP-1 by immunohistochemistry on surgical resection specimens obtained from patients with primary and recurrent bladder cancer.

The results showed that MKP-1 expression is increased in patients with recurrent. In addition, the 3D model of the line of human bladder cancer cells, RT112, was established to determine the role of MKP-1 in drug resistance. The results show that MKP-1 overproduction protected cells against bladder cancer cell death. Instead, MKP-1 knockdown lowered to sensitize cells to die.

FRS2 Antibody

EUR 316

FRS2 Antibody

EUR 146

FRS2 Antibody

39944-100ul 100ul
EUR 390

FRS2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FRS2. Recognizes FRS2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

FRS2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FRS2. Recognizes FRS2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

FRS2 antibody

70R-32753 100 ug
EUR 327
Description: Rabbit polyclonal FRS2 antibody

FRS2 Antibody

AF0103 200ul
EUR 304
Description: FRS2 antibody detects endogenous levels of total FRS2.

FRS2 Antibody

AF6466 200ul
EUR 304
Description: FRS2 Antibody detects endogenous levels of total FRS2.

FRS2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against FRS2. Recognizes FRS2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

FRS2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FRS2. Recognizes FRS2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FRS2 Antibody

ABF6466 100 ug
EUR 438

FRS2 Antibody

ABF0103 100 ug
EUR 438


YF-PA17237 50 ug
EUR 363
Description: Mouse polyclonal to FRS2


YF-PA17238 100 ul
EUR 403
Description: Rabbit polyclonal to FRS2


YF-PA25676 50 ul
EUR 334
Description: Mouse polyclonal to FRS2

FRS2 Blocking Peptide

33R-10946 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FRS2 antibody, catalog no. 70R-12129

FRS2 Blocking Peptide

EUR 153

FRS2 antibody (Tyr436)

70R-34410 100 ug
EUR 327
Description: Rabbit polyclonal FRS2 antibody (Tyr436)

FRS2 (pY196) Antibody

abx215470-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

FRS2 (pT436) Antibody

  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

FRS2 (pY436) Antibody

abx010808-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Polyclonal FRS2 Antibody

APR16029G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FRS2 . This antibody is tested and proven to work in the following applications:

FRS2 Blocking Peptide

AF0103-BP 1mg
EUR 195

FRS2 Blocking Peptide

AF6466-BP 1mg
EUR 195

FRS2 (pY436) Antibody

abx333006-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

FRS2 cloning plasmid

CSB-CL009004HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1539
  • Sequence: atgggtagctgttgtagctgtccagataaagacactgtcccagataaccatcggaacaagtttaaggtcattaatgtggatgatgatgggaatgagttaggttctggcataatggaacttacagacacagaactgattttatacacccgcaaacgtgactcagtaaaatggcact
  • Show more
Description: A cloning plasmid for the FRS2 gene.

FRS2 Polyclonal Antibody

ABP53560-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human FRS2 around the non-phosphorylation site of Y436
  • Applications tips:
Description: A polyclonal antibody for detection of FRS2 from Human, Mouse. This FRS2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human FRS2 around the non-phosphorylation site of Y436

FRS2 Polyclonal Antibody

ABP53560-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human FRS2 around the non-phosphorylation site of Y436
  • Applications tips:
Description: A polyclonal antibody for detection of FRS2 from Human, Mouse. This FRS2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human FRS2 around the non-phosphorylation site of Y436

FRS2 Polyclonal Antibody

ABP53560-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human FRS2 around the non-phosphorylation site of Y436
  • Applications tips:
Description: A polyclonal antibody for detection of FRS2 from Human, Mouse. This FRS2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human FRS2 around the non-phosphorylation site of Y436

FRS2 Polyclonal Antibody

ABP51377-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human FRS2 around the non-phosphorylation site of Y196
  • Applications tips:
Description: A polyclonal antibody for detection of FRS2 from Human, Mouse. This FRS2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human FRS2 around the non-phosphorylation site of Y196

FRS2 Polyclonal Antibody

ABP51377-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human FRS2 around the non-phosphorylation site of Y196
  • Applications tips:
Description: A polyclonal antibody for detection of FRS2 from Human, Mouse. This FRS2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human FRS2 around the non-phosphorylation site of Y196

FRS2 Polyclonal Antibody

ABP51377-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human FRS2 around the non-phosphorylation site of Y196
  • Applications tips:
Description: A polyclonal antibody for detection of FRS2 from Human, Mouse. This FRS2 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human FRS2 around the non-phosphorylation site of Y196

FRS2 Polyclonal Antibody

ES4559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FRS2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

FRS2 Polyclonal Antibody

ES4559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FRS2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

FRS2 Polyclonal Antibody

ES2376-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FRS2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

FRS2 Polyclonal Antibody

ES2376-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FRS2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- FRS2 antibody

FNab03225 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: fibroblast growth factor receptor substrate 2
  • Uniprot ID: Q8WU20
  • Gene ID: 10818
  • Research Area: Signal Transduction
Description: Antibody raised against FRS2

Anti-FRS2 antibody

PAab03225 100 ug
EUR 355

Anti-FRS2 antibody

STJ93156 200 µl
EUR 197
Description: Rabbit polyclonal to FRS2.

Anti-FRS2 antibody

STJ93157 200 µl
EUR 197
Description: Rabbit polyclonal to FRS2.

Anti-FRS2 antibody

STJ73094 100 µg
EUR 359

FRS2 (Ab-196) Antibody

33254-100ul 100ul
EUR 252

FRS2 (Ab-196) Antibody

33254-50ul 50ul
EUR 187

FRS2 (Phospho-Tyr436) Antibody

11769-100ul 100ul
EUR 252

FRS2 (Phospho-Tyr436) Antibody

11769-50ul 50ul
EUR 187

FRS2 (Phospho-Tyr196) Antibody

12539-100ul 100ul
EUR 252

FRS2 (Phospho-Tyr196) Antibody

12539-50ul 50ul
EUR 187

Phospho-FRS2 (Y436) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-FRS2 (Y436). Recognizes Phospho-FRS2 (Y436) from Human, Mouse, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

Phospho-FRS2 (Tyr436) Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-FRS2 (Tyr436). Recognizes Phospho-FRS2 (Tyr436) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100

Phospho-FRS2 (Tyr436) Antibody

CSB-PA946917-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-FRS2 (Tyr436). Recognizes Phospho-FRS2 (Tyr436) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:1000, IHC:1:50-1:100

FRS2 (Ab-196) Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against FRS2 (Ab-196). Recognizes FRS2 (Ab-196) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

FRS2 (Ab-196) Antibody

CSB-PA208276-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against FRS2 (Ab-196). Recognizes FRS2 (Ab-196) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

FRS2 (pY436) Blocking Peptide

  • EUR 314.00
  • EUR 509.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

FRS2 (Phospho-Tyr436) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Human FRS2 ELISA Kit

EHF0132 96Tests
EUR 521


EGTF0132 96Tests
EUR 521

Bovine FRS2 ELISA Kit

EBF0132 96Tests
EUR 521

Canine FRS2 ELISA Kit

ECF0132 96Tests
EUR 521

Chicken FRS2 ELISA Kit

ECKF0132 96Tests
EUR 521

Anserini FRS2 ELISA Kit

EAF0132 96Tests
EUR 521


EF006838 96 Tests
EUR 689

Polyclonal FRS2 Antibody (Center)

APR16030G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FRS2 (Center). This antibody is tested and proven to work in the following applications:

Phospho-FRS2 (Tyr436) Antibody

AF3466 200ul
EUR 304
Description: Phospho-FRS2 (Tyr436) Antibody detects endogenous levels of FRS2 only when phosphorylated at Tyrosine 436.

FRS2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FRS2. Recognizes FRS2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FRS2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FRS2. Recognizes FRS2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FRS2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FRS2. Recognizes FRS2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human FRS2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Phospho-FRS2 (Tyr196) Antibody

AF8197 200ul
EUR 376
Description: FRS2 (Phospho-Tyr196) Antibody detects endogenous levels of FRS2 only when phosphorylated at Tyr196.

Mouse FRS2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FRS2 (Phospho- Tyr196) Antibody

ABF8197 100 ug
EUR 438

Phospho- FRS2 (Tyr436) Antibody

ABF3466 100 ug
EUR 438

Mouse FRS2 ELISA Kit

EMF0132 96Tests
EUR 521


ERF0132 96Tests
EUR 521

Sheep FRS2 ELISA Kit

ESF0132 96Tests
EUR 521

Rabbit FRS2 ELISA Kit

ERTF0132 96Tests
EUR 521

Monkey FRS2 ELISA Kit

EMKF0132 96Tests
EUR 521

Mouse Frs2 ELISA KIT

ELI-38336m 96 Tests
EUR 865

Porcine FRS2 ELISA Kit

EPF0132 96Tests
EUR 521


ELI-47347h 96 Tests
EUR 824

Anti-FRS2 Monoclonal Antibody

M02798 100ug
EUR 397
Description: Rabbit Monoclonal FRS2 Antibody. Validated in IP, WB and tested in Human.

FRS2 Recombinant Protein (Human)

RP012553 100 ug Ask for price

FRS2 Recombinant Protein (Rat)

RP201782 100 ug Ask for price

FRS2 Recombinant Protein (Mouse)

RP135275 100 ug Ask for price

Anti-FRS2 (1F7-1D6)

YF-MA17494 100 ug
EUR 363
Description: Mouse monoclonal to FRS2

Guinea Pig FRS2 ELISA Kit

EGF0132 96Tests
EUR 521

Phospho-FRS2 (Tyr436) Blocking Peptide

AF3466-BP 1mg
EUR 195

FRS2 (Ab-196) Conjugated Antibody

C33254 100ul
EUR 397

Phospho-FRS2 (Tyr196) Blocking Peptide

AF8197-BP 1mg
EUR 195

FRS2 (phospho Tyr436) Polyclonal Antibody

ABP50497-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human FRS2 around the phosphorylation site of Y436
  • Applications tips:
Description: A polyclonal antibody for detection of FRS2 phospho Tyr436) from Human, Mouse, Monkey. This FRS2 phospho Tyr436) antibody is for WB , IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human FRS2 around the phosphorylation site of Y436

FRS2 (phospho Tyr436) Polyclonal Antibody

ABP50497-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human FRS2 around the phosphorylation site of Y436
  • Applications tips:
Description: A polyclonal antibody for detection of FRS2 phospho Tyr436) from Human, Mouse, Monkey. This FRS2 phospho Tyr436) antibody is for WB , IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human FRS2 around the phosphorylation site of Y436

FRS2 (phospho Tyr436) Polyclonal Antibody

ABP50497-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human FRS2 around the phosphorylation site of Y436
  • Applications tips:
Description: A polyclonal antibody for detection of FRS2 phospho Tyr436) from Human, Mouse, Monkey. This FRS2 phospho Tyr436) antibody is for WB , IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human FRS2 around the phosphorylation site of Y436

FRS2 (phospho Tyr436) Polyclonal Antibody

ES1496-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FRS2 (phospho Tyr436) from Human/Mouse/Monkey. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

FRS2 (phospho Tyr436) Polyclonal Antibody

ES1496-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FRS2 (phospho Tyr436) from Human/Mouse/Monkey. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Frs2 ORF Vector (Rat) (pORF)

ORF067262 1.0 ug DNA
EUR 506

FRS2 ORF Vector (Human) (pORF)

ORF004185 1.0 ug DNA
EUR 95

Frs2 ORF Vector (Mouse) (pORF)

ORF045093 1.0 ug DNA
EUR 506

Anti-Phospho-FRS2 (Y436) antibody

STJ90965 200 µl
EUR 197
Description: Rabbit polyclonal to Phospho-FRS2 (Y436).

FRS2 ELISA Kit (Human) (OKEI00196)

OKEI00196 96 Wells
EUR 767
Description: Description of target: Adapter protein that links activated FGR and NGF receptors to downstream signaling pathways. Plays an important role in the activation of MAP kinases and in the phosphorylation of PIK3R1, the regulatory subunit of phosphatidylinositol 3-kinase, in response to ligand-mediated activation of FGFR1. Modulates signaling via SHC1 by competing for a common binding site on NTRK1.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 9.375 pg/mL

FRS2 ELISA Kit (Mouse) (OKEI00451)

OKEI00451 96 Wells
EUR 767
Description: Description of target: Adapter protein that links activated FGR and NGF receptors to downstream signaling pathways. Plays an important role in the activation of MAP kinases and in the phosphorylation of PIK3R1, the regulatory subunit of phosphatidylinositol 3-kinase, in response to ligand-mediated activation of FGFR1. Modulates signaling via SHC1 by competing for a common binding site on NTRK1.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 4.688 pg/mL

Phospho-FRS2 (Tyr-349) Polyclonal Antibody

EUR 370

FRS2 Colorimetric Cell-Based ELISA Kit

EKC1226 100ul
EUR 572

FRS2 (Phospho-Tyr436) Polyclonal Conjugated Antibody

C11769 100ul
EUR 397

FRS2 (Phospho-Tyr196) Polyclonal Conjugated Antibody

C12539 100ul
EUR 397

Frs2 sgRNA CRISPR Lentivector set (Rat)

K6479601 3 x 1.0 ug
EUR 339

FRS2 sgRNA CRISPR Lentivector set (Human)

K0815201 3 x 1.0 ug
EUR 339

Frs2 sgRNA CRISPR Lentivector set (Mouse)

K3641401 3 x 1.0 ug
EUR 339

Polyclonal Goat Anti-FRS2 Antibody (internal region)

APR16291G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-FRS2 (internal region). This antibody is tested and proven to work in the following applications:

Frs2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6479602 1.0 ug DNA
EUR 154

Frs2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6479603 1.0 ug DNA
EUR 154

Frs2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6479604 1.0 ug DNA
EUR 154

FRS2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0815202 1.0 ug DNA
EUR 154

FRS2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0815203 1.0 ug DNA
EUR 154

FRS2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0815204 1.0 ug DNA
EUR 154

Frs2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3641402 1.0 ug DNA
EUR 154

Frs2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3641403 1.0 ug DNA
EUR 154

Frs2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3641404 1.0 ug DNA
EUR 154

FRS2 Protein Vector (Rat) (pPB-C-His)

PV269046 500 ng
EUR 603

FRS2 Protein Vector (Rat) (pPB-N-His)

PV269047 500 ng
EUR 603

FRS2 Protein Vector (Rat) (pPM-C-HA)

PV269048 500 ng
EUR 603

FRS2 Protein Vector (Rat) (pPM-C-His)

PV269049 500 ng
EUR 603

FRS2 Protein Vector (Mouse) (pPB-C-His)

PV180370 500 ng
EUR 603

FRS2 Protein Vector (Mouse) (pPB-N-His)

PV180371 500 ng
EUR 603

FRS2 Protein Vector (Mouse) (pPM-C-HA)

PV180372 500 ng
EUR 603

FRS2 Protein Vector (Mouse) (pPM-C-His)

PV180373 500 ng
EUR 603

FRS2 Protein Vector (Human) (pPB-C-His)

PV016737 500 ng
EUR 329

FRS2 Protein Vector (Human) (pPB-N-His)

PV016738 500 ng
EUR 329

FRS2 Protein Vector (Human) (pPM-C-HA)

PV016739 500 ng
EUR 329

FRS2 Protein Vector (Human) (pPM-C-His)

PV016740 500 ng
EUR 329

Frs2 3'UTR GFP Stable Cell Line

TU156742 1.0 ml Ask for price

Frs2 3'UTR Luciferase Stable Cell Line

TU106742 1.0 ml Ask for price

Frs2 3'UTR Luciferase Stable Cell Line

TU204795 1.0 ml Ask for price

Frs2 3'UTR GFP Stable Cell Line

TU254795 1.0 ml Ask for price

FRS2 3'UTR GFP Stable Cell Line

TU058299 1.0 ml
EUR 2333

FRS2 3'UTR Luciferase Stable Cell Line

TU008299 1.0 ml
EUR 2333

FRS2 Colorimetric Cell-Based ELISA Kit (OKAG00728)

OKAG00728 96 Wells
EUR 596
Description: Description of target: ;Species reactivity: Human, Mouse;Application: ELISA;Assay info: Assay Type: Cell-Based
Subtype: None
Detection Method: Colorimetric 450 nm;Sensitivity:

Fibroblast Growth Factor Receptor Substrate 2 (FRS2) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fibroblast Growth Factor Receptor Substrate 2 (FRS2) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fibroblast Growth Factor Receptor Substrate 2 (FRS2) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fibroblast Growth Factor Receptor Substrate 2 (FRS2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fibroblast Growth Factor Receptor Substrate 2 (FRS2) Antibody

abx036587-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Fibroblast Growth Factor Receptor Substrate 2 (FRS2) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Fibroblast Growth Factor Receptor Substrate 2 (FRS2) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Fibroblast Growth Factor Receptor Substrate 2 (FRS2) Antibody

abx030590-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Fibroblast Growth Factor Receptor Substrate 2 (FRS2) Antibody

abx030590-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

FRS2 (Phospho-Tyr436) Colorimetric Cell-Based ELISA Kit

EKC2597 100ul
EUR 572

Monoclonal FRS2 Antibody (monoclonal) (M02), Clone: 1F7-1D6

APR16031G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human FRS2 (monoclonal) (M02). The antibodies are raised in Mouse and are from clone 1F7-1D6. This antibody is applicable in WB

Fibroblast Growth Factor Receptor Substrate 2 (FRS2) Antibody

abx233225-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Fibroblast Growth Factor Receptor Substrate 2 (FRS2) Antibody

abx331653-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Fibroblast Growth Factor Receptor Substrate 2 (FRS2) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibroblast Growth Factor Receptor Substrate 2 (FRS2) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibroblast Growth Factor Receptor Substrate 2 (FRS2) Antibody

abx431926-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Fibroblast Growth Factor Receptor Substrate 2 (FRS2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Fibroblast Growth Factor Receptor Substrate 2 (FRS2)

  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8WU20
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Fibroblast Growth Factor Receptor Substrate 2 expressed in: E.coli

Recombinant Fibroblast Growth Factor Receptor Substrate 2 (FRS2)

  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8C180
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 24.6kDa
  • Isoelectric Point: 6.1
Description: Recombinant Mouse Fibroblast Growth Factor Receptor Substrate 2 expressed in: E.coli

Recombinant Fibroblast Growth Factor Receptor Substrate 2 (FRS2)

  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: D4A244
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 24.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Fibroblast Growth Factor Receptor Substrate 2 expressed in: E.coli

Human Fibroblast Growth Factor Receptor Substrate 2 (FRS2) Protein

  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Fibroblast Growth Factor Receptor Substrate 2 (FRS2) Protein

  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Fibroblast Growth Factor Receptor Substrate 2 (FRS2) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fibroblast Growth Factor Receptor Substrate 2 (FRS2) Blocking Peptide

  • EUR 286.00
  • EUR 425.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Fibroblast Growth Factor Receptor Substrate 2 (FRS2) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibroblast Growth Factor Receptor Substrate 2 (FRS2) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibroblast Growth Factor Receptor Substrate 2 (FRS2) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibroblast Growth Factor Receptor Substrate 2 (FRS2) ELISA Kit

abx595239-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Phospho-FRS2 (Tyr436) Colorimetric Cell-Based ELISA Kit (OKAG02149)

OKAG02149 2 x 96 Wells
EUR 740
Description: Description of target: ;Species reactivity: Human: Y436, Mouse: Y436;Application: ELISA;Assay info: Assay Type: Cell-Based
Subtype: Phospho
Detection Method: Colorimetric 450 nm;Sensitivity:

Mouse Fibroblast Growth Factor Receptor Substrate 2 (FRS2) CLIA Kit

abx196951-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Fibroblast Growth Factor Receptor Substrate 2 (FRS2) ELISA Kit

abx254085-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Fibroblast Growth Factor Receptor Substrate 2 (FRS2) ELISA Kit

abx252483-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human FRS2(Fibroblast Growth Factor Receptor Substrate 2) ELISA Kit

EH3084 96T
EUR 524.1
  • Detection range: 15.625-1000 pg/ml
  • Uniprot ID: Q8WU20
  • Alias: FRS2/FRS2alpha/SNT1/FGFR signalling adaptor/FGFR-signaling adaptor SNT/fibroblast growth factor receptor substrate 2/FRS2A/FRS2alpha/SNT/SNT1/SNT-1FGFR substrate 2/Suc1-associated neurotrop
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Monkey Fibroblast Growth Factor Receptor Substrate 2 (FRS2) ELISA Kit

abx359831-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Fibroblast Growth Factor Receptor Substrate 2 (FRS2) ELISA Kit

abx361590-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Fibroblast Growth Factor Receptor Substrate 2 (FRS2) ELISA Kit

abx362533-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Fibroblast Growth Factor Receptor Substrate 2 (FRS2) ELISA Kit

abx356227-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Fibroblast Growth Factor Receptor Substrate 2 (FRS2) ELISA Kit

abx364732-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Mouse FRS2(Fibroblast Growth Factor Receptor Substrate 2) ELISA Kit

EM1034 96T
EUR 524.1
  • Detection range: 7.813-500 pg/ml
  • Uniprot ID: Q8C180
  • Alias: FRS2/FRS2alpha/SNT1/FGFR signalling adaptor/FGFR-signaling adaptor SNT/fibroblast growth factor receptor substrate 2/FRS2A/FRS2alpha/SNT/SNT1/SNT-1FGFR substrate 2/Suc1-associated neurotrophi
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 4.688pg/ml

Frs2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6479605 3 x 1.0 ug
EUR 376

FRS2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0815205 3 x 1.0 ug
EUR 376

Frs2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3641405 3 x 1.0 ug
EUR 376

Fibroblast Growth Factor Receptor Substrate 2 (FRS2) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FRS2 (Leu268~Pro453)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse Fibroblast Growth Factor Receptor Substrate 2 (FRS2)

Rat Fibroblast Growth Factor Receptor SubstRate 2(FRS2)ELISA Kit

QY-E10305 96T
EUR 361

Mouse Fibroblast Growth Factor Receptor SubstMousee 2(FRS2)ELISA Kit

QY-E20591 96T
EUR 361

CLIA kit for Mouse FRS2 (Fibroblast Growth Factor Receptor Substrate 2)

E-CL-M0305 1 plate of 96 wells
EUR 584
  • Gentaur's FRS2 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Mouse FRS2 . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Mouse FRS2 (Fibroblast Growth Factor Receptor Substrate 2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human FRS2 (Fibroblast Growth Factor Receptor Substrate 2)

E-EL-H1120 1 plate of 96 wells
EUR 534
  • Gentaur's FRS2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human FRS2. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human FRS2 (Fibroblast Growth Factor Receptor Substrate 2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse FRS2 (Fibroblast Growth Factor Receptor Substrate 2)

E-EL-M0502 1 plate of 96 wells
EUR 534
  • Gentaur's FRS2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse FRS2. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse FRS2 (Fibroblast Growth Factor Receptor Substrate 2) in samples from Serum, Plasma, Cell supernatant

Guinea pig Fibroblast Growth Factor Receptor Substrate 2 (FRS2) ELISA Kit

abx357696-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Fibroblast Growth Factor Receptor Substrate 2 Phospho-Tyr436 (FRS2 pY436) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Frs2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6479606 1.0 ug DNA
EUR 167

Frs2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6479607 1.0 ug DNA
EUR 167

Frs2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6479608 1.0 ug DNA
EUR 167

In addition, the application of MAPK inhibitors effectively increase the sensitivity of cells to pirarubicin RT112. In conclusion, the results of this study show that MKP-1 treatment resulted in bladder cancer cell chemoresistance through JNK, ERK and p38 pathways. MKP-1 can also serve as a potential therapeutic target for chemoresistance in patients with bladder cancer.