Igkc Antibody Reactivity In Mouse

Lab Reagents

Human IgG antibody Laboratories manufactures the igkc antibody reactivity in mouse reagents distributed by Genprice. The Igkc Antibody Reactivity In Mouse reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact mouse Antibody. Other Igkc products are available in stock. Specificity: Igkc Category: Antibody Group: Reactivity In

Reactivity In information

IGKC Antibody, Biotin conjugated

1-CSB-PA011340LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IGKC. Recognizes IGKC from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

IGKC cloning plasmid

CSB-CL011340HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 705
  • Sequence: atgagggtccccgctcagctcctggggctcctgctgctctggctcccaggtgccagatgtgccatccggatgacccagtctccatcctcattctctgcatctacaggagacagagtcaccatcacttgtcgggcgagtcagagtattggtagttatttagcctggtatcagcaaaa
  • Show more
Description: A cloning plasmid for the IGKC gene.

IGKC cloning plasmid

CSB-CL011340HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 711
  • Sequence: atggacatgagggtcccctctcagctcctggggctcctgctgctctggctcccaggtgccagatgtgacatccagttgacccagtctccatccttcctgtctgcatctgtaggagacagagtcaccatcacttgccgggccagtcagggcattagcagttatttagcctggtatca
  • Show more
Description: A cloning plasmid for the IGKC gene.

IGKC cloning plasmid

CSB-CL011340HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 714
  • Sequence: atggacatgagggtccccgctcagctcctggggctcctgctgctctggttcccaggttccagatgcgacatccacatgacccagtctccatcttctgtgtctgcatctgtaggagacagagtcaccatcacctgtcgggcgagtcagcgtattagcagcagctggttagcctggta
  • Show more
Description: A cloning plasmid for the IGKC gene.

IGKC cloning plasmid

CSB-CL011340HU4-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 723
  • Sequence: ATGAGGCTCCCTGCTCAGCTCCTGGGGCTGCTAATGCTCTGGGTCCCAGGATCCAGTGGGGATGTTGTGATGACTCAGTCTCCACTCTCCCTGCCCGTCACCCTTGGACAGCCGGCCTCCATCTCCTGCAGGTCTAGTCAAAGCCTCGTATACAGTGATGGAAACACCTACTTGAA
  • Show more
Description: A cloning plasmid for the IGKC gene.

IGKC Recombinant Protein (Human)

RP015805 100 ug Ask for price

IGKC Recombinant Protein (Human)

RP015808 100 ug Ask for price

IGKC Recombinant Protein (Human)

RP015811 100 ug Ask for price

IGKC Recombinant Protein (Human)

RP040006 100 ug Ask for price

IGKC ORF Vector (Human) (pORF)

ORF005269 1.0 ug DNA
EUR 95

IGKC ORF Vector (Human) (pORF)

ORF005270 1.0 ug DNA
EUR 95

IGKC ORF Vector (Human) (pORF)

ORF005271 1.0 ug DNA
EUR 95

IGKC ORF Vector (Human) (pORF)

ORF013336 1.0 ug DNA
EUR 354

Kappa Light Chain/ IGKC MonoSpecific Antibody, Unconjugated-20ug

3514-MSM10-P0 20ug
EUR 233

Kappa Light Chain/ IGKC MonoSpecific Antibody, Unconjugated-100ug

3514-MSM10-P1 100ug
EUR 428

IGKC sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1049805 3 x 1.0 ug
EUR 376

IGKC sgRNA CRISPR Lentivector set (Human)

K1049801 3 x 1.0 ug
EUR 339