Muscle transcriptome analysis identifies genes involved in ciliogenesis and the molecular cascade associated with intramuscular fat content in Large White heavy pigs

Muscle transcriptome analysis identifies genes involved in ciliogenesis and the molecular cascade associated with intramuscular fat content in Large White heavy pigs

the content of intramuscular fat (IMF) is a complex trait that affects the sensory and technological features of the product determines the quality of meat and pork. Thus, we aimed to analyze through RNA-semimembranosus muscle transcriptome sequencing of Italian white large pig to study gene networks associated with the deposition of the IMF. Two groups of samples used; each consisting of six pigs is not associated with extreme and divergent IMF content (0.67 ± 0.09% in the low IMF vs. 6.81 ± 1.17% in the group of high IMF) selected from 950 individuals of the original race.

Paired-end RNA sequences were aligned with Sus scrofa 11.1 assembling genomes and gene number was analyzed by using WGCNA and DeSeq2 in the neighborhood R. Interestingly, among the 58 genes differentially expressed (degs), some associated with primary ciliary organelles (such Lebercilin 5 gene), in addition to genes involved in the regulation of cell differentiation, in the control of RNA-processing, and G-protein and ERK signaling pathway. Together with genes associated with cilia, we also found in pigs IMF high over-expression of Fibroblast Growth Factor 2 (FGF2) gene, which in other animal species found to be a regulator of ciliogenesis.

WGCNA module four genes would produce significant results of analyzes related to the deposition of the IMF: grey60 (P = 0.003), darkturquoise (P = 0.022), skyblue1 (P = 0.022), and lavenderblush3 (P = 0.030). Genes in a significant module confirmed the . Among the complex molecular affecting fat depot muscle, genes involved in cilia primer may have an important role, and reprogramming transcription observed in pigs IMF height can be associated with a cascade related molecules FGF and ciliogenesis, which in the literature has been associated with the differentiation of precursor fibro-adipogenic.

 Muscle transcriptome analysis identifies genes involved in ciliogenesis and the molecular cascade associated with intramuscular fat content in Large White heavy pigs
Muscle transcriptome analysis identifies genes involved in ciliogenesis and the molecular cascade associated with intramuscular fat content in Large White heavy pigs

differential response to kinase inhibition in triple negative breast cancer cells FGFR2-addiction: phosphoproteomics quantitative studies.

Fibroblast Growth Factor (FGF) signaling depends frequently activated in cancer by different mechanisms. However, the downstream signal transduction pathways involved are poorly characterized. Here differential quantitative approach phosphoproteomics, SILAC, applied to identify phosphorylation events FGF-arranged in two tumor cell lines triple negative breast, MFM223 and SUM52, that exhibit enhanced expression of FGF receptor 2 (FGFR2) and depending on the advanced FGFR2 signaling for cell survival.

Gene Ontology Comparative proteome analysis revealed that cells enriched SUM52 proteins associated with cell metabolism and cell MFM223 enriched proteins associated with cell adhesion and migration. FGFR2 inhibition by SU5402 impact of a significant fraction of phosphoproteome observed from these cells. This study extends the known landscape of FGF signaling and identify many new targets for functional investigations.

Chicken Fibroblast Growth Factor 9 (FGF9) ELISA Kit

DLR-FGF9-Ch-48T 48T
EUR 454
  • Should the Chicken Fibroblast Growth Factor 9 (FGF9) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken Fibroblast Growth Factor 9 (FGF9) in samples from serum, plasma or other biological fluids.

Chicken Fibroblast Growth Factor 9 (FGF9) ELISA Kit

DLR-FGF9-Ch-96T 96T
EUR 587
  • Should the Chicken Fibroblast Growth Factor 9 (FGF9) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken Fibroblast Growth Factor 9 (FGF9) in samples from serum, plasma or other biological fluids.

Human Fibroblast Growth Factor 9 (FGF9) ELISA Kit

DLR-FGF9-Hu-48T 48T
EUR 425
  • Should the Human Fibroblast Growth Factor 9 (FGF9) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fibroblast Growth Factor 9 (FGF9) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Fibroblast Growth Factor 9 (FGF9) ELISA Kit

DLR-FGF9-Hu-96T 96T
EUR 548
  • Should the Human Fibroblast Growth Factor 9 (FGF9) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fibroblast Growth Factor 9 (FGF9) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Fibroblast Growth Factor 9 (FGF9) ELISA Kit

DLR-FGF9-Mu-48T 48T
EUR 435
  • Should the Mouse Fibroblast Growth Factor 9 (FGF9) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Fibroblast Growth Factor 9 (FGF9) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Fibroblast Growth Factor 9 (FGF9) ELISA Kit

DLR-FGF9-Mu-96T 96T
EUR 561
  • Should the Mouse Fibroblast Growth Factor 9 (FGF9) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Fibroblast Growth Factor 9 (FGF9) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Fibroblast Growth Factor 9 (FGF9) ELISA Kit

DLR-FGF9-Ra-48T 48T
EUR 454
  • Should the Rat Fibroblast Growth Factor 9 (FGF9) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Fibroblast Growth Factor 9 (FGF9) in samples from serum, plasma or other biological fluids.

Rat Fibroblast Growth Factor 9 (FGF9) ELISA Kit

DLR-FGF9-Ra-96T 96T
EUR 587
  • Should the Rat Fibroblast Growth Factor 9 (FGF9) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Fibroblast Growth Factor 9 (FGF9) in samples from serum, plasma or other biological fluids.

Bovine Fibroblast Growth Factor 9 (FGF9) ELISA Kit

RDR-FGF9-b-48Tests 48 Tests
EUR 516

Bovine Fibroblast Growth Factor 9 (FGF9) ELISA Kit

RDR-FGF9-b-96Tests 96 Tests
EUR 716

Chicken Fibroblast Growth Factor 9 (FGF9) ELISA Kit

RDR-FGF9-Ch-48Tests 48 Tests
EUR 470

Chicken Fibroblast Growth Factor 9 (FGF9) ELISA Kit

RDR-FGF9-Ch-96Tests 96 Tests
EUR 651

Human Fibroblast Growth Factor 9 (FGF9) ELISA Kit

RDR-FGF9-Hu-48Tests 48 Tests
EUR 436

Human Fibroblast Growth Factor 9 (FGF9) ELISA Kit

RDR-FGF9-Hu-96Tests 96 Tests
EUR 601

Mouse Fibroblast Growth Factor 9 (FGF9) ELISA Kit

RDR-FGF9-Mu-48Tests 48 Tests
EUR 447

Mouse Fibroblast Growth Factor 9 (FGF9) ELISA Kit

RDR-FGF9-Mu-96Tests 96 Tests
EUR 618

Rat Fibroblast Growth Factor 9 (FGF9) ELISA Kit

RDR-FGF9-Ra-48Tests 48 Tests
EUR 470

Rat Fibroblast Growth Factor 9 (FGF9) ELISA Kit

RDR-FGF9-Ra-96Tests 96 Tests
EUR 651

Bovine Fibroblast Growth Factor 9 (FGF9) ELISA Kit

RD-FGF9-b-48Tests 48 Tests
EUR 494

Bovine Fibroblast Growth Factor 9 (FGF9) ELISA Kit

RD-FGF9-b-96Tests 96 Tests
EUR 684

Chicken Fibroblast Growth Factor 9 (FGF9) ELISA Kit

RD-FGF9-Ch-48Tests 48 Tests
EUR 450

Chicken Fibroblast Growth Factor 9 (FGF9) ELISA Kit

RD-FGF9-Ch-96Tests 96 Tests
EUR 622

Human Fibroblast Growth Factor 9 (FGF9) ELISA Kit

RD-FGF9-Hu-48Tests 48 Tests
EUR 418

Human Fibroblast Growth Factor 9 (FGF9) ELISA Kit

RD-FGF9-Hu-96Tests 96 Tests
EUR 575

Mouse Fibroblast Growth Factor 9 (FGF9) ELISA Kit

RD-FGF9-Mu-48Tests 48 Tests
EUR 429

Mouse Fibroblast Growth Factor 9 (FGF9) ELISA Kit

RD-FGF9-Mu-96Tests 96 Tests
EUR 591

Rat Fibroblast Growth Factor 9 (FGF9) ELISA Kit

RD-FGF9-Ra-48Tests 48 Tests
EUR 450

Rat Fibroblast Growth Factor 9 (FGF9) ELISA Kit

RD-FGF9-Ra-96Tests 96 Tests
EUR 622

FGF9 protein

30R-2441 20 ug
EUR 325
Description: Purified recombinant Human FGF9 protein

FGF9 protein

30R-2442 10 ug
EUR 375
Description: Purified recombinant Mouse FGF9 protein

FGF9 protein

30R-2443 10 ug
EUR 375
Description: Purified recombinant Human FGF9 protein

FGF9 protein

30R-AF011 20 ug
EUR 273
Description: Purified recombinant Human FGF9 protein

FGF9 protein

30R-AG036 10 ug
EUR 273
Description: Purified recombinant Human FGF9 protein

FGF9 antibody

70R-13992 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal FGF9 antibody

FGF9 antibody

70R-13993 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal FGF9 antibody

FGF9 Antibody

35651-100ul 100ul
EUR 252

FGF9 antibody

38859-100ul 100ul
EUR 252

FGF9 Antibody

1-CSB-PA005068
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FGF9. Recognizes FGF9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

FGF9 Antibody

DF9532 200ul
EUR 304
Description: FGF9 Antibody detects endogenous levels of total FGF9.

FGF9 Antibody

1-CSB-PA171435
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FGF9. Recognizes FGF9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

FGF9 Antibody

1-CSB-PA215086
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FGF9. Recognizes FGF9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

FGF9 antibody

70R-FR001 100 ug
EUR 327
Description: Affinity purified Rabbit polyclonal FGF9 antibody

FGF9 antibody

70R-FR012 50 ug
EUR 273
Description: Affinity purified Rabbit polyclonal FGF9 antibody

FGF9 Antibody

1-CSB-PA008638ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FGF9. Recognizes FGF9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

FGF9 siRNA

20-abx901955
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FGF9 siRNA

20-abx916838
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FGF9 siRNA

20-abx916839
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FGF9 Antibody

ABD9532 100 ug
EUR 438

anti-FGF9

YF-PA23705 50 ul
EUR 334
Description: Mouse polyclonal to FGF9

FGF9 Rabbit pAb

A14691-100ul 100 ul
EUR 308

FGF9 Rabbit pAb

A14691-200ul 200 ul
EUR 459

FGF9 Rabbit pAb

A14691-20ul 20 ul Ask for price

FGF9 Rabbit pAb

A14691-50ul 50 ul Ask for price

Polyclonal FGF9 Antibody

APR04791G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FGF9 . This antibody is tested and proven to work in the following applications:

FGF9 Blocking Peptide

DF9532-BP 1mg
EUR 195

Anti-FGF9 Antibody

A02274 100ug/vial
EUR 294

FGF9 Conjugated Antibody

C35651 100ul
EUR 397

FGF9 Conjugated Antibody

C38859 100ul
EUR 397

FGF9 cloning plasmid

CSB-CL008638HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 627
  • Sequence: ATGGCTCCCTTAGGTGAAGTTGGGAACTATTTCGGTGTGCAGGATGCGGTACCGTTTGGGAATGTGCCCGTGTTGCCGGTGGACAGCCCGGTTTTGTTAAGTGACCACCTGGGTCAGTCCGAAGCAGGGGGGCTCCCCAGGGGACCCGCAGTCACGGACTTGGATCATTTAAAGGG
  • Show more
Description: A cloning plasmid for the FGF9 gene.

FGF9 Rabbit pAb

A6374-100ul 100 ul
EUR 308

FGF9 Rabbit pAb

A6374-200ul 200 ul
EUR 459

FGF9 Rabbit pAb

A6374-20ul 20 ul
EUR 183

FGF9 Rabbit pAb

A6374-50ul 50 ul
EUR 223

Anti-FGF9 Antibody

PA1453 100ug/vial
EUR 334

Anti-FGF9 antibody

STJ28457 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein was isolated as a secreted factor that exhibits a growth-stimulating effect on cultured glial cells. In nervous system, this protein is produced mainly by neurons and may be important for glial cell development. Expression of the mouse homolog of this gene was found to be dependent on Sonic hedgehog (Shh) signaling. Mice lacking the homolog gene displayed a male-to-female sex reversal phenotype, which suggested a role in testicular embryogenesis.

Anti-FGF9 antibody

STJ116892 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein was isolated as a secreted factor that exhibits a growth-stimulating effect on cultured glial cells. In nervous system, this protein is produced mainly by neurons and may be important for glial cell development. Expression of the mouse homolog of this gene was found to be dependent on Sonic hedgehog (Shh) signaling. Mice lacking the homolog gene displayed a male-to-female sex reversal phenotype, which suggested a role in testicular embryogenesis.

Human FGF9 ELISA Kit

55R-1573 1 kit
EUR 671
Description: ELISA kit for detection of FGF9 in the research laboratory

Human FGF9 ELISA kit

55R-2058 96 tests
EUR 712
Description: ELISA Kit for detection of FGF9 in the research laboratory

Human FGF9 ELISA Kit

ELA-E0036h 96 Tests
EUR 824

Human FGF9 ELISA Kit

EHF0080 96Tests
EUR 521

Goat FGF9 ELISA Kit

EGTF0080 96Tests
EUR 521

Bovine FGF9 ELISA Kit

EBF0080 96Tests
EUR 521

Canine FGF9 ELISA Kit

ECF0080 96Tests
EUR 521

Chicken FGF9 ELISA Kit

ECKF0080 96Tests
EUR 521

Anserini FGF9 ELISA Kit

EAF0080 96Tests
EUR 521

FGF9 ELISA KIT|Human

EF000106 96 Tests
EUR 689

Rat FGF9 shRNA Plasmid

20-abx985030
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse FGF9 shRNA Plasmid

20-abx970328
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FGF9 shRNA Plasmid

20-abx951574
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse FGF9 ELISA Kit

EMF0080 96Tests
EUR 521

Rat FGF9 ELISA Kit

ERF0080 96Tests
EUR 521

Sheep FGF9 ELISA Kit

ESF0080 96Tests
EUR 521

Rabbit FGF9 ELISA Kit

ERTF0080 96Tests
EUR 521

Monkey FGF9 ELISA Kit

EMKF0080 96Tests
EUR 521

Porcine FGF9 ELISA Kit

EPF0080 96Tests
EUR 521

Human FGF9 ELISA kit

LF-EK50041 1×96T
EUR 659

Mouse FGF9 ELISA Kit

STJ150292 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of FGF9 in Mouse serum, plasma and other biological fluids

ELISA kit for Human FGF9

EK5143 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human FGF9 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human FGF9 PicoKine ELISA Kit

EK0348 96 wells
EUR 486
Description: For quantitative detection of human FGF9 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Guinea Pig FGF9 ELISA Kit

EGF0080 96Tests
EUR 521

Human FGF9 ELISA kit (4X96T)

LF-EK50042 4×96T
EUR 2242

Fgf9 ORF Vector (Rat) (pORF)

ORF067110 1.0 ug DNA
EUR 506

FGF9 ORF Vector (Human) (pORF)

ORF013035 1.0 ug DNA
EUR 95

Fgf9 ORF Vector (Mouse) (pORF)

ORF044835 1.0 ug DNA
EUR 506

pECMV-Fgf9-m-FLAG Plasmid

PVT14967 2 ug
EUR 325

FGF9 ELISA Kit (Human) (OKAN04846)

OKAN04846 96 Wells
EUR 792
Description: Description of target: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein was isolated as a secreted factor that exhibits a growth-stimulating effect on cultured glial cells. In nervous system, this protein is produced mainly by neurons and may be important for glial cell development. Expression of the mouse homolog of this gene was found to be dependent on Sonic hedgehog (Shh) signaling. Mice lacking the homolog gene displayed a male-to-female sex reversal phenotype, which suggested a role in testicular embryogenesis.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.5 pg/mL

FGF9 ELISA Kit (Mouse) (OKAN06615)

OKAN06615 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.4 pg/mL

FGF9 ELISA Kit (Human) (OKBB00144)

OKBB00144 96 Tests
EUR 583
Description: Description of target: Fibroblast growth factor-9 (FGF-9) is a steroid-regulated mitogen and survival factor for nerve and mesenchymal cells.1 The human FGF-9 cDNA cloned by using oligonucleotide probes encodes a polypeptide consisting of 208 amino acids. Sequence similarity to other members of the FGF family has been estimated to be around 30%.2 FGF-9 is an autocrine estromedin endometrial stromal growth factor that plays roles in cyclic proliferation of uterine endometrial stroma.3 FGF9 is produced and secreted by the prostatic stromal cells. It is a potent mitogen for both prostatic epithelial and stromal cells in culture. FGF9 is an abundant secreted growth factor that can act as both a paracrine mitogen for epithelial cells and an autocrine mitogen for stromal cells. Overexpression of this paracrine and autocrine growth factor may play an important role in the epithelial and stromal proliferation in benign prostatic hyperplasia.4 As a result of glycosylation, the molecular mass is 25-27KDa.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 15 pg/ml

FGF9 ELISA Kit (Bovine) (OKBB00700)

OKBB00700 96 Wells
EUR 583
Description: Description of target: Fibroblast growth factor-9(FGF-9) is a steroid-regulated mitogen and survival factor for nerve and mesenchymal cells. The Bovine FGF-9 cDNA cloned by using oligonucleotide probes encodes a polypeptide consisting of 208 amino acids. Sequence similarity to other members of the FGF family has been estimated to be around 30%. FGF-9 is an autocrine estromedin endometrial stromal growth factor that plays roles in cyclic proliferation of uterine endometrial stroma. FGF9 is produced and secreted by the prostatic stromal cells. It is a potent mitogen for both prostatic epithelial and stromal cells in culture. FGF9 is an abundant secreted growth factor that can act as both a paracrine mitogen for epithelial cells and an autocrine mitogen for stromal cells. Overexpression of this paracrine and autocrine growth factor may play an important role in the epithelial and stromal proliferation in benign prostatic hyperplasia.4 As a result of glycosylation, the molecular mass is 25-27KDa.;Species reactivity: Bovine;Application: ELISA;Assay info: ;Sensitivity: <15pg/ml

FGF9 ELISA Kit (Horse) (OKBB00701)

OKBB00701 96 Wells
EUR 583
Description: Description of target: Fibroblast growth factor-9(FGF-9) is a steroid-regulated mitogen and survival factor for nerve and mesenchymal cells. The horse equine FGF-9 cDNA cloned by using oligonucleotide probes encodes a polypeptide consisting of 208 amino acids. Sequence similarity to other members of the FGF family has been estimated to be around 30%. FGF-9 is an autocrine estromedin endometrial stromal growth factor that plays roles in cyclic proliferation of uterine endometrial stroma. FGF9 is produced and secreted by the prostatic stromal cells. It is a potent mitogen for both prostatic epithelial and stromal cells in culture. FGF9 is an abundant secreted growth factor that can act as both a paracrine mitogen for epithelial cells and an autocrine mitogen for stromal cells. Overexpression of this paracrine and autocrine growth factor may play an important role in the epithelial and stromal proliferation in benign prostatic hyperplasia.4 As a result of glycosylation, the molecular mass is 25-27KDa.;Species reactivity: Horse;Application: ELISA;Assay info: ;Sensitivity: <15pg/ml

FGF9 ELISA Kit (Pig) (OKBB00702)

OKBB00702 96 Wells
EUR 583
Description: Description of target: Fibroblast growth factor-9(FGF-9) is a steroid-regulated mitogen and survival factor for nerve and mesenchymal cells. The Pig porcine FGF-9 cDNA cloned by using oligonucleotide probes encodes a polypeptide consisting of 208 amino acids. Sequence similarity to other members of the FGF family has been estimated to be around 30%. FGF-9 is an autocrine estromedin endometrial stromal growth factor that plays roles in cyclic proliferation of uterine endometrial stroma. FGF9 is produced and secreted by the prostatic stromal cells. It is a potent mitogen for both prostatic epithelial and stromal cells in culture. FGF9 is an abundant secreted growth factor that can act as both a paracrine mitogen for epithelial cells and an autocrine mitogen for stromal cells. Overexpression of this paracrine and autocrine growth factor may play an important role in the epithelial and stromal proliferation in benign prostatic hyperplasia.4 As a result of glycosylation, the molecular mass is 25-27KDa.;Species reactivity: Pig;Application: ELISA;Assay info: ;Sensitivity: <15pg/ml

FGF9 ELISA Kit (Rabbit) (OKBB00703)

OKBB00703 96 Wells
EUR 583
Description: Description of target: Fibroblast growth factor-9(FGF-9) is a steroid-regulated mitogen and survival factor for nerve and mesenchymal cells. The rabbit FGF-9 cDNA cloned by using oligonucleotide probes encodes a polypeptide consisting of 208 amino acids. Sequence similarity to other members of the FGF family has been estimated to be around 30%. FGF-9 is an autocrine estromedin endometrial stromal growth factor that plays roles in cyclic proliferation of uterine endometrial stroma. FGF9 is produced and secreted by the prostatic stromal cells. It is a potent mitogen for both prostatic epithelial and stromal cells in culture. FGF9 is an abundant secreted growth factor that can act as both a paracrine mitogen for epithelial cells and an autocrine mitogen for stromal cells. Overexpression of this paracrine and autocrine growth factor may play an important role in the epithelial and stromal proliferation in benign prostatic hyperplasia.4 As a result of glycosylation, the molecular mass is 25-27KDa.;Species reactivity: Rabbit;Application: ELISA;Assay info: ;Sensitivity: <15pg/ml

FGF9 ELISA Kit (Human) (OKCD05696)

OKCD05696 96 Wells
EUR 753
Description: Description of target: Recombinant Human Fibroblast Growth Factor-9;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 6.6pg/mL

FGF9 ELISA Kit (Mouse) (OKCD05697)

OKCD05697 96 Wells
EUR 779
Description: Description of target: The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein was isolated as a secreted factor that exhibits a growth-stimulating effect on cultured glial cells. In nervous system, this protein is produced mainly by neurons and may be important for glial cell development. Expression of the mouse homolog of this gene was found to be dependent on Sonic hedgehog (Shh) signaling. Mice lacking the homolog gene displayed a male-to-female sex reversal phenotype, which suggested a role in testicular embryogenesis.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 6.2pg/mL

FGF9 ELISA Kit (Rat) (OKCD05698)

OKCD05698 96 Wells
EUR 818
Description: Description of target: human homolog is a heparin-binding growth factor.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 6.7pg/mL

FGF9 ELISA Kit (Pig) (OKEH07241)

OKEH07241 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39pg/mL

FGF9 ELISA Kit (Rat) (OKEH04121)

OKEH04121 96 Wells
EUR 662
Description: Description of target: human homolog is a heparin-binding growth factor [RGD, Feb 2006];Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.6 pg/mL

FGF9 ELISA Kit (Mouse) (OKEH04122)

OKEH04122 96 Wells
EUR 662
Description: Description of target: Plays an important role in the regulation of embryonic development, cell proliferation, cell differentiation and cell migration. May have a role in glial cell growth and differentiation during development, gliosis during repair and regeneration of brain tissue after damage, differentiation and survival of neuronal cells, and growth stimulation of glial tumors.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.62 pg/mL

Active Fibroblast Growth Factor 9 (FGF9)

4-APA036Hu01
  • EUR 712.86
  • EUR 294.00
  • EUR 2398.24
  • EUR 866.08
  • EUR 1632.16
  • EUR 540.00
  • EUR 5845.60
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P31371
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 24.7kDa
  • Isoelectric Point: 6.9
Description: Recombinant Human Fibroblast Growth Factor 9 expressed in: Available from E.coli, Yeast, Baculovirus and Mammalian cells

Fibroblast Growth Factor 9 (FGF9) Antibody

20-abx004874
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 9 (FGF9) Antibody

20-abx176445
  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Fibroblast Growth Factor 9 (FGF9) Antibody

20-abx176446
  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Fibroblast Growth Factor 9 (FGF9) Antibody

20-abx176447
  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Fibroblast Growth Factor 9 (FGF9) Antibody

20-abx176448
  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Fibroblast Growth Factor 9 (FGF9) Antibody

20-abx176449
  • EUR 1288.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Fibroblast Growth Factor 9 (FGF9) Antibody

20-abx176450
  • EUR 1288.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Fibroblast Growth Factor 9 (FGF9) Antibody

20-abx213709
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 9 (FGF9) Antibody

20-abx128486
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fibroblast Growth Factor 9 (FGF9) Antibody

20-abx133760
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 9 (FGF9) Antibody

abx145935-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 9 (FGF9) Antibody

20-abx172418
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Fibroblast Growth Factor 9 (FGF9) Antibody

20-abx172419
  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Fibroblast Growth Factor 9 (FGF9) Antibody

20-abx172420
  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Fibroblast Growth Factor 9 (FGF9) Antibody

20-abx172421
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Fibroblast Growth Factor 9 (FGF9) Antibody

20-abx242104
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Bovine FGF9 PicoKine™ ELISA Kit

EK0348-BV 96 wells
EUR 486
Description: Sandwich High Sensitivity ELISA kit for Quantitative Detection of Bovine FGF9. 96wells/kit, with removable strips.

Rabbit FGF9 PicoKine™ ELISA Kit

EK0348-RB 96 wells
EUR 486
Description: Sandwich High Sensitivity ELISA kit for Quantitative Detection of rabbit FGF9. 96wells/kit, with removable strips.

Polyclonal Fgf9 Antibody - N-terminal region

APR11928G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Fgf9 - N-terminal region. This antibody is tested and proven to work in the following applications:

Fibroblast Growth Factor 9 (FGF9) Antibody

20-abx320610
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fibroblast Growth Factor 9 (FGF9) Antibody

20-abx327456
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fgf9 sgRNA CRISPR Lentivector set (Mouse)

K4969201 3 x 1.0 ug
EUR 339

Fgf9 sgRNA CRISPR Lentivector set (Rat)

K6815401 3 x 1.0 ug
EUR 339

FGF9 sgRNA CRISPR Lentivector set (Human)

K0778001 3 x 1.0 ug
EUR 339

Recombinant Fibroblast Growth Factor 9 (FGF9)

4-RPA036Hu01
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P31371
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 24.7kDa
  • Isoelectric Point: 6.9
Description: Recombinant Human Fibroblast Growth Factor 9 expressed in: E.coli

Rat Glia-activating factor(FGF9) ELISA kit

E02G0407-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Glia-activating factor(FGF9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Glia-activating factor(FGF9) ELISA kit

E02G0407-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Glia-activating factor(FGF9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Glia-activating factor(FGF9) ELISA kit

E02G0407-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Glia-activating factor(FGF9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Glia-activating factor(FGF9) ELISA kit

E03G0407-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Glia-activating factor(FGF9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Glia-activating factor(FGF9) ELISA kit

E03G0407-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Glia-activating factor(FGF9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Glia-activating factor(FGF9) ELISA kit

E03G0407-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Glia-activating factor(FGF9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Glia-activating factor(FGF9) ELISA kit

E04G0407-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Glia-activating factor(FGF9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Glia-activating factor(FGF9) ELISA kit

E04G0407-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Glia-activating factor(FGF9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Glia-activating factor(FGF9) ELISA kit

E04G0407-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Glia-activating factor(FGF9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glia-activating factor(FGF9) ELISA kit

E01G0407-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Glia-activating factor(FGF9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glia-activating factor(FGF9) ELISA kit

E01G0407-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Glia-activating factor(FGF9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Glia-activating factor(FGF9) ELISA kit

E01G0407-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Glia-activating factor(FGF9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Glia-activating factor(FGF9) ELISA kit

E06G0407-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Glia-activating factor(FGF9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Glia-activating factor(FGF9) ELISA kit

E06G0407-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Glia-activating factor(FGF9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Glia-activating factor(FGF9) ELISA kit

E06G0407-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Glia-activating factor(FGF9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Fibroblast Growth Factor 9 (FGF9) Protein

20-abx066611
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fibroblast Growth Factor 9 (FGF9) Blocking Peptide

20-abx061342
  • EUR 286.00
  • EUR 425.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Monkey Glia-activating factor(FGF9) ELISA kit

E09G0407-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Glia-activating factor(FGF9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Glia-activating factor(FGF9) ELISA kit

E09G0407-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Glia-activating factor(FGF9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Glia-activating factor(FGF9) ELISA kit

E09G0407-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Glia-activating factor(FGF9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Horse equine FGF9 PicoKine™ ELISA Kit

EK0348-EQ 96 wells
EUR 486
Description: Sandwich High Sensitivity ELISA kit for Quantitative Detection of horse equine FGF9. 96wells/kit, with removable strips.

Pig porcine FGF9 PicoKine™ ELISA Kit

EK0348-PO 96 wells
EUR 486
Description: Sandwich High Sensitivity ELISA kit for Quantitative Detection of Pig porcine FGF9. 96wells/kit, with removable strips.

Dog Glia-activating factor(FGF9) ELISA kit

E08G0407-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Glia-activating factor(FGF9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Glia-activating factor(FGF9) ELISA kit

E08G0407-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Glia-activating factor(FGF9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Glia-activating factor(FGF9) ELISA kit

E08G0407-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Glia-activating factor(FGF9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Glia-activating factor(FGF9) ELISA kit

E07G0407-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Glia-activating factor(FGF9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Glia-activating factor(FGF9) ELISA kit

E07G0407-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Glia-activating factor(FGF9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Glia-activating factor(FGF9) ELISA kit

E07G0407-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Glia-activating factor(FGF9) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Fibroblast Growth Factor 9 (FGF9) Antibody Pair

20-abx370851
  • EUR 1595.00
  • EUR 1024.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-12 working days.

Mouse Fibroblast Growth Factor 9 (FGF9) Protein

20-abx653409
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Fibroblast Growth Factor 9 (FGF9) Protein

20-abx653410
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rat Fibroblast Growth Factor 9 (FGF9) Protein

20-abx653411
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Cow Fibroblast Growth Factor 9 (FGF9) Protein

20-abx653412
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Chicken Fibroblast Growth Factor 9 (FGF9) Protein

20-abx653413
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Pig Fibroblast Growth Factor 9 (FGF9) Protein

20-abx653414
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Fibroblast Growth Factor 9 (FGF9) Antibody (Biotin)

20-abx274643
  • EUR 425.00
  • EUR 230.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Fgf9(Glia-activating factor) ELISA Kit

EM0330 96T
EUR 524.1
  • Detection range: 62.5-4000 pg/ml
  • Uniprot ID: P54130
  • Alias: FGF9/FGF-9/GAF/HBFG-9/HBGF-9/MGC119914/MGC119915/SYNS3
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 37.5pg/ml

Fgf9 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4969202 1.0 ug DNA
EUR 154

Fgf9 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4969203 1.0 ug DNA
EUR 154

Fgf9 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4969204 1.0 ug DNA
EUR 154

Fgf9 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6815402 1.0 ug DNA
EUR 154

Fgf9 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6815403 1.0 ug DNA
EUR 154

Fgf9 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6815404 1.0 ug DNA
EUR 154

FGF9 sgRNA CRISPR Lentivector (Human) (Target 1)

K0778002 1.0 ug DNA
EUR 154

FGF9 sgRNA CRISPR Lentivector (Human) (Target 2)

K0778003 1.0 ug DNA
EUR 154

FGF9 sgRNA CRISPR Lentivector (Human) (Target 3)

K0778004 1.0 ug DNA
EUR 154

FGF9 Protein Vector (Mouse) (pPB-C-His)

PV179338 500 ng
EUR 603

FGF9 Protein Vector (Mouse) (pPB-N-His)

PV179339 500 ng
EUR 603

FGF9 Protein Vector (Mouse) (pPM-C-HA)

PV179340 500 ng
EUR 603

FGF9 Protein Vector (Mouse) (pPM-C-His)

PV179341 500 ng
EUR 603

FGF9 Protein Vector (Rat) (pPB-C-His)

PV268438 500 ng
EUR 603

FGF9 Protein Vector (Rat) (pPB-N-His)

PV268439 500 ng
EUR 603

FGF9 Protein Vector (Rat) (pPM-C-HA)

PV268440 500 ng
EUR 603

FGF9 Protein Vector (Rat) (pPM-C-His)

PV268441 500 ng
EUR 603

FGF9 Protein Vector (Human) (pPB-C-His)

PV052137 500 ng
EUR 481

FGF9 Protein Vector (Human) (pPB-N-His)

PV052138 500 ng
EUR 481

FGF signaling pathway is found to be flexible in architecture as both shared and divergent, in response to the FGFR2 kinase inhibitory activity in canonical RAF / MAPK / ERK / RSK and PI3K / AKT / PDK / mTOR / S6K pathways identified. Inhibition of the negative feedback path dependent phosphorylation observed, defining the FGFR2 inhibitory mechanisms of intrinsic resistance. These findings have implications for FGFR inhibitor therapy applications because they identify both common and different responses in cells of the same genetic lesion hides and pathways of drug resistance.

Leave A Comment