Transient receptor potential channel TRPV4 mediates TGF-β1-induced differentiation of human ventricular fibroblasts.

Transient receptor potential channel TRPV4 mediates TGF-β1-induced differentiation of human ventricular fibroblasts.

cardiac fibroblasts (CF) is the principal extracellular matrix-producing cells. In response to injury, CF transdifferentiate into myofibroblasts. Intracellular calcium (Ca2 +) signals, are involved in fibroblast proliferation and differentiation, activated in fibroblasts via the transient receptor potential (TRP) channels, but the function of this channel has not been studied in human ventricular CF. Under evaluation in this study, is the role of TRP channels in the differentiation of human-induced ventricular CF by changing the growth factor beta (TGF-β), a pro-fibrotic cytokine.Human CF ventricular used in this study.

CF to myofibroblast differentiation induced by TGF-β and identified by the expression of smooth muscle actin.Results showed that Ca2 + signaling is an important component of differentiation CF ventricle. CF treated with TGF-β showed an increased expression of the channel TRP, TRPV4, both at the mRNA and protein levels, which are associated with CF-myofibroblast trans-differentiation, as evidenced by the upregulation of actin muscle α-smooth, a myofibroblast marker, and plasminogen activator inhibitor -1, which is a marker of fibrogenesis.

TRPV4 agonist-induced conversion of CF into myofibroblasts, while it is also an antagonist of Ca2 + chelating agents is reduced, showing that Ca2 + influx is required for CF throughTRPV4 trans-differentiation. Overall, these results suggest that TRPV4-mediated Ca2 + influx participate in regulating differentiation into myofibroblasts CF human ventricle through the MAPK / ERK pathway.

Overall, these results suggest that TRPV4-mediated Ca2 + influx participate in regulating differentiation into myofibroblasts CF human ventricle through pathways MAPK / ERK.

 Transient receptor potential channel TRPV4 mediates TGF-β1-induced differentiation of human ventricular fibroblasts.
Transient receptor potential channel TRPV4 mediates TGF-β1-induced differentiation of human ventricular fibroblasts.

Effect of dual inhibition of Ras-MEK-ERK pathway and GSK3β on developing rabbit embryos cultured in vitro.

Dual inhibition (2i) of the pathway Ras-MEK-ERK and GSK3β allowing the derivation of embryonic stem cells (ESCs) from mouse strain flame retardant and, for strains of permissive, allowing the ESC derivation with no involvement of protein factors external stimuli. Additionally, blocking ERK signals in the 8-cell-stage mouse embryos leads to ablation GATA4 / 6 expression in hypoblasts, showing fibroblast growth factor (FGF) dependence hypoblast formation in mouse.

In humans, cattle or pig embryo, hypoblast remains unaffected or show little to moderate decrease in the number of cells. In this study, we showed that the separation of the hypoblast and epiblast in embryonic rabbit is independent FGF and 2i treatment elicits only limited gains in favor of OCT4-positive epiblast population to population hypoblast GATA4- / 6-positive. Previously been shown that TGFβ / Activin A inhibition overcome pervasive and inhomogeneity differentiation of iPSCs rat, mouse ESCs and iPSCs humans while encouraging them to acquire naive nature.

However, TGFβ / Activin A inhibition, alone or together with a Rho-associated, coiled-coil containing protein kinase (ROCK) inhibition, are not compatible with the survival of rabbit embryos by preimplantation rabbit embryos ultrastructural analysis by electron microscopy. In a rabbit model of ovulation in mating allows the exact timing of the development of the pregnancy.

Human Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) ELISA Kit

RD-FGFRL1-Hu-48Tests 48 Tests
EUR 503

Human Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) ELISA Kit

RD-FGFRL1-Hu-96Tests 96 Tests
EUR 697

Human Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) ELISA Kit

RDR-FGFRL1-Hu-48Tests 48 Tests
EUR 525

Human Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) ELISA Kit

RDR-FGFRL1-Hu-96Tests 96 Tests
EUR 729

Fgfrl1/ Rat Fgfrl1 ELISA Kit

ELI-43996r 96 Tests
EUR 886

FGFRL1 siRNA

20-abx901961
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FGFRL1 siRNA

20-abx916856
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FGFRL1 siRNA

20-abx916857
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FGFRL1 Antibody

35217-100ul 100ul
EUR 252

FGFRL1 Antibody

35217-50ul 50ul
EUR 187

FGFRL1 Antibody

1-CSB-PA926721
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FGFRL1. Recognizes FGFRL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

FGFRL1 Antibody

CSB-PA285693-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against FGFRL1. Recognizes FGFRL1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

FGFRL1 Antibody

CSB-PA285693-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against FGFRL1. Recognizes FGFRL1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

FGFRL1 Antibody

1-CSB-PA008650LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FGFRL1. Recognizes FGFRL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:500-1:1000, IF:1:50-1:200

FGFRL1 Antibody

1-CSB-PA028033
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FGFRL1. Recognizes FGFRL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:200-1:1000, IHC:1:100-1:300

FGFRL1 Antibody

1-CSB-PA030096
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against FGFRL1. Recognizes FGFRL1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

FGFRL1 Conjugated Antibody

C35217 100ul
EUR 397

FGFRL1 cloning plasmid

CSB-CL008650HU1-10ug 10ug
EUR 534
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1515
  • Sequence: atgacgccgagccccctgttgctgctcctgctgccgccgctgctgctgggggccttcccgccggccgccgccgcccgaggccccccaaagatggcggacaaggtggtcccacggcaggtggcccggctgggccgcactgtgcggctgcagtgcccagtggagggggacccgccgc
  • Show more
Description: A cloning plasmid for the FGFRL1 gene.

FGFRL1 cloning plasmid

CSB-CL008650HU2-10ug 10ug
EUR 405
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1053
  • Sequence: atgaggcgccgggtgatcgcacggcccgtgggtagctccgtgcggctcaagtgcgtggccagcgggcaccctcggcccgacatcacgtggatgaaggacgaccaggccttgacgcgcccagaggccgctgagcccaggaagaagaagtggacactgagcctgaagaacctgcggc
  • Show more
Description: A cloning plasmid for the FGFRL1 gene.

FGFRL1 Polyclonal Antibody

A68531 100 ?g
EUR 628.55
Description: reagents widely cited

Mouse FGFRL1 shRNA Plasmid

20-abx980193
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat FGFRL1 shRNA Plasmid

20-abx990122
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Fgfrl1 ELISA KIT

ELI-20811m 96 Tests
EUR 865

Chicken FGFRL1 ELISA KIT

ELI-07776c 96 Tests
EUR 928

FGFRL1 ELISA KIT|Human

EF004984 96 Tests
EUR 689

Human FGFRL1 ELISA KIT

ELI-48464h 96 Tests
EUR 824

Human FGFRL1 shRNA Plasmid

20-abx959989
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FGFRL1 Antibody, HRP conjugated

1-CSB-PA008650LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FGFRL1. Recognizes FGFRL1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FGFRL1 Antibody, FITC conjugated

1-CSB-PA008650LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FGFRL1. Recognizes FGFRL1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FGFRL1 Antibody, Biotin conjugated

1-CSB-PA008650LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FGFRL1. Recognizes FGFRL1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal FGFRL1 Antibody (N-term)

APR15978G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FGFRL1 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal FGFRL1 Antibody - middle region

APR15979G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FGFRL1 - middle region. This antibody is tested and proven to work in the following applications:

Human FGFRL1 PicoKine ELISA Kit

EK2079 96 wells
EUR 425
Description: For quantitative detection of human FGFRL1 in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

FGFRL1 Polyclonal Antibody, HRP Conjugated

A68532 100 ?g
EUR 628.55
Description: Ask the seller for details

FGFRL1 Polyclonal Antibody, FITC Conjugated

A68533 100 ?g
EUR 628.55
Description: The best epigenetics products

FGFRL1 Polyclonal Antibody, Biotin Conjugated

A68534 100 ?g
EUR 628.55
Description: kits suitable for this type of research

FGFRL1 ORF Vector (Human) (pORF)

ORF004046 1.0 ug DNA
EUR 95

FGFRL1 ORF Vector (Human) (pORF)

ORF004047 1.0 ug DNA
EUR 95

Fgfrl1 ORF Vector (Rat) (pORF)

ORF067123 1.0 ug DNA
EUR 506

Fgfrl1 ORF Vector (Mouse) (pORF)

ORF044852 1.0 ug DNA
EUR 506

Fgfrl1 ORF Vector (Mouse) (pORF)

ORF044853 1.0 ug DNA
EUR 506

FGFRL1 ELISA Kit (Human) (OKCD00602)

OKCD00602 96 Wells
EUR 909
Description: Description of target: Has a negative effect on cell proliferation.By similarity ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.051 ng/mL

FGFRL1 ELISA Kit (Human) (OKDD00267)

OKDD00267 96 Wells
EUR 936
Description: Description of target: The protein encoded by this gene is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. A marked difference between this gene product and the other family members is its lack of a cytoplasmic tyrosine kinase domain. The result is a transmembrane receptor that could interact with other family members and potentially inhibit signaling. Multiple alternatively spliced transcript variants encoding the same isoform have been found for this gene.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.051 ng/mL

FGFRL1 ELISA Kit (Human) (OKBB01446)

OKBB01446 96 Wells
EUR 505
Description: Description of target: Fibroblast growth factor receptor-like 1 is a protein that in humans is encoded by the FGFRL1 gene. It is mapped to 4p16.3. The protein encoded by this gene is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. A marked difference between this gene product and the other family members is its lack of a cytoplasmic tyrosine kinase domain. The result is a transmembrane receptor that could interact with other family members and potentially inhibit signaling. Multiple alternatively spliced transcript variants encoding the same isoform have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

FGFRL1 sgRNA CRISPR Lentivector set (Human)

K0780501 3 x 1.0 ug
EUR 339

Fgfrl1 sgRNA CRISPR Lentivector set (Mouse)

K3702201 3 x 1.0 ug
EUR 339

Fgfrl1 sgRNA CRISPR Lentivector set (Rat)

K7439201 3 x 1.0 ug
EUR 339

Recombinant Human FGF R5/FGFRL1 Protein

RP00134 20 μg
EUR 183

Recombinant Human FGF R5/FGFRL1 (C-6His)

C520-10ug 10ug
EUR 121
Description: Lyophilized from a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, pH 8.0.

Recombinant Human FGF R5/FGFRL1 (C-6His)

C520-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, pH 8.0.

Recombinant Human FGF R5/FGFRL1 (C-6His)

C520-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, pH 8.0.

Recombinant Human FGF R5/FGFRL1 (C-6His)

C520-50ug 50ug
EUR 263
Description: Lyophilized from a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, pH 8.0.

FGFRL1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0780502 1.0 ug DNA
EUR 154

FGFRL1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0780503 1.0 ug DNA
EUR 154

FGFRL1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0780504 1.0 ug DNA
EUR 154

Fgfrl1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3702202 1.0 ug DNA
EUR 154

Fgfrl1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3702203 1.0 ug DNA
EUR 154

Fgfrl1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3702204 1.0 ug DNA
EUR 154

Fgfrl1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7439202 1.0 ug DNA
EUR 154

Fgfrl1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7439203 1.0 ug DNA
EUR 154

Fgfrl1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7439204 1.0 ug DNA
EUR 154

FGFRL1 Protein Vector (Rat) (pPB-C-His)

PV268490 500 ng
EUR 603

FGFRL1 Protein Vector (Rat) (pPB-N-His)

PV268491 500 ng
EUR 603

FGFRL1 Protein Vector (Rat) (pPM-C-HA)

PV268492 500 ng
EUR 603

FGFRL1 Protein Vector (Rat) (pPM-C-His)

PV268493 500 ng
EUR 603

FGFRL1 Protein Vector (Mouse) (pPB-C-His)

PV179406 500 ng
EUR 603

FGFRL1 Protein Vector (Mouse) (pPB-N-His)

PV179407 500 ng
EUR 603

FGFRL1 Protein Vector (Mouse) (pPM-C-HA)

PV179408 500 ng
EUR 603

FGFRL1 Protein Vector (Mouse) (pPM-C-His)

PV179409 500 ng
EUR 603

FGFRL1 Protein Vector (Mouse) (pPB-C-His)

PV179410 500 ng
EUR 603

FGFRL1 Protein Vector (Mouse) (pPB-N-His)

PV179411 500 ng
EUR 603

FGFRL1 Protein Vector (Mouse) (pPM-C-HA)

PV179412 500 ng
EUR 603

FGFRL1 Protein Vector (Mouse) (pPM-C-His)

PV179413 500 ng
EUR 603

FGFRL1 Protein Vector (Human) (pPB-C-His)

PV016181 500 ng
EUR 329

FGFRL1 Protein Vector (Human) (pPB-N-His)

PV016182 500 ng
EUR 329

FGFRL1 Protein Vector (Human) (pPM-C-HA)

PV016183 500 ng
EUR 329

FGFRL1 Protein Vector (Human) (pPM-C-His)

PV016184 500 ng
EUR 329

FGFRL1 Protein Vector (Human) (pPB-C-His)

PV016185 500 ng
EUR 329

FGFRL1 Protein Vector (Human) (pPB-N-His)

PV016186 500 ng
EUR 329

FGFRL1 Protein Vector (Human) (pPM-C-HA)

PV016187 500 ng
EUR 329

FGFRL1 Protein Vector (Human) (pPM-C-His)

PV016188 500 ng
EUR 329

Fgfrl1 3'UTR Luciferase Stable Cell Line

TU204623 1.0 ml Ask for price

Fgfrl1 3'UTR GFP Stable Cell Line

TU156558 1.0 ml Ask for price

FGFRL1 3'UTR Luciferase Stable Cell Line

TU007953 1.0 ml
EUR 1521

Fgfrl1 3'UTR Luciferase Stable Cell Line

TU106558 1.0 ml Ask for price

FGFRL1 3'UTR GFP Stable Cell Line

TU057953 1.0 ml
EUR 1521

Fgfrl1 3'UTR GFP Stable Cell Line

TU254623 1.0 ml Ask for price

Fibroblast Growth Factor Receptor Like 1 (FGFRL1) Antibody

abx026978-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Fibroblast Growth Factor Receptor Like 1 (FGFRL1) Antibody

abx026978-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

FGFRL1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV678121 1.0 ug DNA
EUR 682

FGFRL1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV678125 1.0 ug DNA
EUR 682

FGFRL1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV678126 1.0 ug DNA
EUR 682

FGFRL1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV710145 1.0 ug DNA
EUR 316

FGFRL1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV710149 1.0 ug DNA
EUR 316

FGFRL1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV710150 1.0 ug DNA
EUR 316

Fgfrl1 ELISA Kit| Mouse Fibroblast growth factor receptor-like

EF014924 96 Tests
EUR 689

FGFRL1 ELISA Kit| chicken Fibroblast growth factor receptor-lik

EF012305 96 Tests
EUR 689

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Antibody

20-abx104527
  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Antibody

20-abx104528
  • EUR 467.00
  • EUR 133.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Antibody

20-abx104529
  • EUR 481.00
  • EUR 133.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Antibody

20-abx172426
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Antibody

20-abx325588
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Antibody

20-abx213762
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Antibody

abx331774-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Antibody

20-abx334166
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Antibody

20-abx241098
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human CellExp? FGFR5 / FGFRL1 Protein, Fc Tag, Human Recombinant

P1376-10
EUR 207

Recombinant Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1)

4-RPL113Hu01
  • EUR 483.49
  • EUR 232.00
  • EUR 1538.08
  • EUR 579.36
  • EUR 1058.72
  • EUR 386.00
  • EUR 3695.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8N441
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Fibroblast Growth Factor Receptor Like Protein 1 expressed in: E.coli

Recombinant Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1)

4-RPL113Mu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q91V87
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Fibroblast Growth Factor Receptor Like Protein 1 expressed in: E.coli

Recombinant Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1)

4-RPL113Ra01
  • EUR 510.37
  • EUR 239.00
  • EUR 1638.88
  • EUR 612.96
  • EUR 1125.92
  • EUR 404.00
  • EUR 3947.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q7TQM3
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Fibroblast Growth Factor Receptor Like Protein 1 expressed in: E.coli

Fgfrl1 ELISA Kit| Rat Fibroblast growth factor receptor-like 1

EF018689 96 Tests
EUR 689

FGFRL1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0780505 3 x 1.0 ug
EUR 376

Human Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Protein

20-abx066616
  • EUR 676.00
  • EUR 272.00
  • EUR 2068.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Protein

20-abx066617
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Protein

20-abx066618
  • EUR 718.00
  • EUR 286.00
  • EUR 2207.00
  • EUR 843.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Antibody (HRP)

20-abx335700
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Antibody (FITC)

20-abx335701
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Antibody (Biotin)

20-abx335702
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse Fibroblast Growth Factor Receptor Like 1 (FGFRL1) ELISA Kit

abx389293-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Fibroblast Growth Factor Receptor Like 1 (FGFRL1) ELISA Kit

abx391334-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Fgfrl1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3702205 3 x 1.0 ug
EUR 376

Fgfrl1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7439205 3 x 1.0 ug
EUR 376

Human Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) CLIA Kit

20-abx495883
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

FGFRL1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0780506 1.0 ug DNA
EUR 167

FGFRL1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0780507 1.0 ug DNA
EUR 167

FGFRL1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0780508 1.0 ug DNA
EUR 167

Human Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) ELISA Kit

20-abx151534
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Fgfrl1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3702206 1.0 ug DNA
EUR 167

Fgfrl1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3702207 1.0 ug DNA
EUR 167

Fgfrl1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3702208 1.0 ug DNA
EUR 167

Fgfrl1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7439206 1.0 ug DNA
EUR 167

Fgfrl1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7439207 1.0 ug DNA
EUR 167

Fgfrl1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7439208 1.0 ug DNA
EUR 167

FGFRL1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV678122 1.0 ug DNA
EUR 682

FGFRL1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV678123 1.0 ug DNA
EUR 740

FGFRL1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV678124 1.0 ug DNA
EUR 740

FGFRL1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV710146 1.0 ug DNA
EUR 316

FGFRL1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV710147 1.0 ug DNA
EUR 374

FGFRL1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV710148 1.0 ug DNA
EUR 374

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Polyclonal Antibody (Human)

4-PAL113Hu01
  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FGFRL1 (Val168~Pro378)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1)

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Polyclonal Antibody (Mouse)

4-PAL113Mu01
  • EUR 266.00
  • EUR 2813.00
  • EUR 694.00
  • EUR 337.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FGFRL1 (Val164~Pro374)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1)

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Polyclonal Antibody (Rat)

4-PAL113Ra01
  • EUR 275.00
  • EUR 2958.00
  • EUR 727.00
  • EUR 350.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FGFRL1 (Val164~Thr368)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1)

Human Fibroblast Growth Factor Receptor Like Protein 1(FGFRL1)ELISA Kit

QY-E04006 96T
EUR 394

Human Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) ELISA Kit

SEL113Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) in Tissue homogenates and other biological fluids.

Human Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) ELISA Kit

SEL113Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) in Tissue homogenates and other biological fluids.

Human Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) ELISA Kit

SEL113Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) in Tissue homogenates and other biological fluids.

Human Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) ELISA Kit

SEL113Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) in Tissue homogenates and other biological fluids.

Human Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) ELISA Kit

4-SEL113Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Fibroblast Growth Factor Receptor Like Protein 1 elisa. Alternative names of the recognized antigen: FGFR5
  • FHFR
  • FGF homologous factor receptor
  • FGFR-like protein
  • Fibroblast growth factor receptor 5
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

ELISA kit for Human FGFRL1 (Fibroblast Growth Factor Receptor Like Protein 1)

ELK6446 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugat
  • Show more
Description: A sandwich ELISA kit for detection of Fibroblast Growth Factor Receptor Like Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Polyclonal Antibody (Human), APC

4-PAL113Hu01-APC
  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FGFRL1 (Val168~Pro378)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1). This antibody is labeled with APC.

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Polyclonal Antibody (Human), Biotinylated

4-PAL113Hu01-Biotin
  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FGFRL1 (Val168~Pro378)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1). This antibody is labeled with Biotin.

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Polyclonal Antibody (Human), Cy3

4-PAL113Hu01-Cy3
  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FGFRL1 (Val168~Pro378)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1). This antibody is labeled with Cy3.

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Polyclonal Antibody (Human), FITC

4-PAL113Hu01-FITC
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FGFRL1 (Val168~Pro378)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1). This antibody is labeled with FITC.

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Polyclonal Antibody (Human), HRP

4-PAL113Hu01-HRP
  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FGFRL1 (Val168~Pro378)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1). This antibody is labeled with HRP.

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Polyclonal Antibody (Human), PE

4-PAL113Hu01-PE
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FGFRL1 (Val168~Pro378)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1). This antibody is labeled with PE.

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Polyclonal Antibody (Mouse), APC

4-PAL113Mu01-APC
  • EUR 374.00
  • EUR 3689.00
  • EUR 1016.00
  • EUR 481.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FGFRL1 (Val164~Pro374)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1). This antibody is labeled with APC.

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Polyclonal Antibody (Mouse), Biotinylated

4-PAL113Mu01-Biotin
  • EUR 332.00
  • EUR 2763.00
  • EUR 803.00
  • EUR 411.00
  • EUR 228.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FGFRL1 (Val164~Pro374)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1). This antibody is labeled with Biotin.

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Polyclonal Antibody (Mouse), Cy3

4-PAL113Mu01-Cy3
  • EUR 457.00
  • EUR 4877.00
  • EUR 1313.00
  • EUR 600.00
  • EUR 267.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FGFRL1 (Val164~Pro374)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1). This antibody is labeled with Cy3.

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Polyclonal Antibody (Mouse), FITC

4-PAL113Mu01-FITC
  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FGFRL1 (Val164~Pro374)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1). This antibody is labeled with FITC.

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Polyclonal Antibody (Mouse), HRP

4-PAL113Mu01-HRP
  • EUR 341.00
  • EUR 3213.00
  • EUR 897.00
  • EUR 433.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FGFRL1 (Val164~Pro374)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1). This antibody is labeled with HRP.

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Polyclonal Antibody (Mouse), PE

4-PAL113Mu01-PE
  • EUR 319.00
  • EUR 2971.00
  • EUR 832.00
  • EUR 405.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FGFRL1 (Val164~Pro374)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1). This antibody is labeled with PE.

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Polyclonal Antibody (Rat), APC

4-PAL113Ra01-APC
  • EUR 388.00
  • EUR 3887.00
  • EUR 1065.00
  • EUR 501.00
  • EUR 237.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FGFRL1 (Val164~Thr368)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1). This antibody is labeled with APC.

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Polyclonal Antibody (Rat), Biotinylated

4-PAL113Ra01-Biotin
  • EUR 343.00
  • EUR 2908.00
  • EUR 839.00
  • EUR 425.00
  • EUR 232.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FGFRL1 (Val164~Thr368)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1). This antibody is labeled with Biotin.

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Polyclonal Antibody (Rat), Cy3

4-PAL113Ra01-Cy3
  • EUR 476.00
  • EUR 5141.00
  • EUR 1379.00
  • EUR 626.00
  • EUR 275.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FGFRL1 (Val164~Thr368)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1). This antibody is labeled with Cy3.

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Polyclonal Antibody (Rat), FITC

4-PAL113Ra01-FITC
  • EUR 330.00
  • EUR 3129.00
  • EUR 872.00
  • EUR 420.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FGFRL1 (Val164~Thr368)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1). This antibody is labeled with FITC.

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Polyclonal Antibody (Rat), HRP

4-PAL113Ra01-HRP
  • EUR 353.00
  • EUR 3385.00
  • EUR 940.00
  • EUR 451.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FGFRL1 (Val164~Thr368)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1). This antibody is labeled with HRP.

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Polyclonal Antibody (Rat), PE

4-PAL113Ra01-PE
  • EUR 330.00
  • EUR 3129.00
  • EUR 872.00
  • EUR 420.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FGFRL1 (Val164~Thr368)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1). This antibody is labeled with PE.

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Polyclonal Antibody (Human), APC-Cy7

4-PAL113Hu01-APC-Cy7
  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FGFRL1 (Val168~Pro378)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1). This antibody is labeled with APC-Cy7.

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Polyclonal Antibody (Mouse), APC-Cy7

4-PAL113Mu01-APC-Cy7
  • EUR 628.00
  • EUR 7258.00
  • EUR 1912.00
  • EUR 842.00
  • EUR 344.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FGFRL1 (Val164~Pro374)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1). This antibody is labeled with APC-Cy7.

Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1) Polyclonal Antibody (Rat), APC-Cy7

4-PAL113Ra01-APC-Cy7
  • EUR 657.00
  • EUR 7654.00
  • EUR 2011.00
  • EUR 882.00
  • EUR 355.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FGFRL1 (Val164~Thr368)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Fibroblast Growth Factor Receptor Like Protein 1 (FGFRL1). This antibody is labeled with APC-Cy7.

It produces some desired stage embryos in the pregnancy and a relatively short gestation period, making the rabbit embryo find a suitable model for cellular functions and mechanisms of maintenance of pluripotency in embryonic cells and embryonic stem cells derived from other mammals.

Leave A Comment